Incidental Mutation 'R4920:Ccr9'
ID378520
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Namechemokine (C-C motif) receptor 9
SynonymsCmkbr10, GPR-9-6
MMRRC Submission 042522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4920 (G1)
Quality Score204
Status Validated
Chromosome9
Chromosomal Location123678439-123784330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123779439 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 62 (G62V)
Ref Sequence ENSEMBL: ENSMUSP00000137144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
Predicted Effect probably damaging
Transcript: ENSMUST00000111454
AA Change: G50V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: G50V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163559
AA Change: G62V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: G62V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166236
AA Change: G62V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: G62V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168910
AA Change: G62V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: G62V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172093
Predicted Effect probably damaging
Transcript: ENSMUST00000180093
AA Change: G62V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: G62V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214413
Meta Mutation Damage Score 0.9658 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092K14Rik A T 11: 114,199,045 noncoding transcript Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Apbb1ip A G 2: 22,819,684 D51G unknown Het
Arntl A G 7: 113,285,114 T120A probably damaging Het
Brca1 A T 11: 101,524,959 V783D probably damaging Het
Ccdc141 T C 2: 77,168,563 D58G probably damaging Het
Ces2b T C 8: 104,836,906 Y422H probably benign Het
Cpa4 T C 6: 30,568,463 probably null Het
Dennd3 A G 15: 73,540,725 H412R probably benign Het
Dpy19l3 A T 7: 35,708,042 probably benign Het
Dtwd2 G T 18: 49,698,440 R167S possibly damaging Het
Dync1i2 G A 2: 71,247,324 R243Q probably damaging Het
Ear2 G A 14: 44,103,125 G80E probably damaging Het
Fam171b A G 2: 83,880,359 K792E possibly damaging Het
Fam83b G A 9: 76,491,868 T651I probably benign Het
Fcrl5 T G 3: 87,444,173 F243V probably damaging Het
Galntl6 T C 8: 58,427,773 I115M probably damaging Het
Glrx3 A G 7: 137,464,130 D163G probably null Het
Gm13089 T C 4: 143,699,283 D30G probably benign Het
Gm14488 A T 2: 30,715,032 noncoding transcript Het
Gm973 T C 1: 59,627,566 S683P probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Gsdmd T C 15: 75,864,357 S112P probably damaging Het
Ighv14-3 A G 12: 114,060,257 V6A probably benign Het
Lca5l T A 16: 96,178,835 S32C probably damaging Het
Lrba T A 3: 86,664,458 Y260* probably null Het
Lyst T C 13: 13,647,060 S1340P possibly damaging Het
Mfsd13a T G 19: 46,367,216 F59V probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Noa1 T C 5: 77,306,487 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Papd4 G A 13: 93,186,325 Q39* probably null Het
Pgm2 C T 4: 99,986,733 T571M probably damaging Het
Rfc1 C A 5: 65,287,928 V460F probably damaging Het
Rrn3 A G 16: 13,790,639 D182G probably benign Het
Sap25 T A 5: 137,642,245 probably benign Het
Slc9a2 A G 1: 40,755,718 I480V probably benign Het
Smo T C 6: 29,759,594 S642P probably damaging Het
Tbc1d22a A C 15: 86,311,748 I307L probably benign Het
Ubr3 A G 2: 69,952,868 Q716R probably benign Het
Vmn2r96 A G 17: 18,582,656 E276G probably benign Het
Zfp189 G A 4: 49,529,302 C135Y probably damaging Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123780044 missense probably benign 0.00
IGL00983:Ccr9 APN 9 123779286 missense probably benign
IGL02466:Ccr9 APN 9 123779846 missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123774573 utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123779536 missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123774552 utr 5 prime probably benign
R0393:Ccr9 UTSW 9 123779970 missense probably benign 0.18
R0421:Ccr9 UTSW 9 123779606 missense probably benign
R2069:Ccr9 UTSW 9 123779364 missense probably benign 0.05
R3980:Ccr9 UTSW 9 123779376 missense probably benign 0.14
R4645:Ccr9 UTSW 9 123779593 missense probably benign 0.00
R4672:Ccr9 UTSW 9 123779687 missense probably damaging 0.96
R5661:Ccr9 UTSW 9 123780099 missense probably benign 0.04
R5964:Ccr9 UTSW 9 123779434 missense probably benign 0.12
R7037:Ccr9 UTSW 9 123779971 missense possibly damaging 0.52
R7500:Ccr9 UTSW 9 123779469 missense probably damaging 1.00
R7620:Ccr9 UTSW 9 123779846 missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123779306 missense probably damaging 0.98
R7762:Ccr9 UTSW 9 123779957 missense probably benign 0.08
X0026:Ccr9 UTSW 9 123779501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTACCATCAGACCTGATCACTC -3'
(R):5'- TGCACATGAAGGTCTGGAAC -3'

Sequencing Primer
(F):5'- AGTTATCCTTGACTGAATGCTATCC -3'
(R):5'- TGGAACATCCATTGACCAGCAG -3'
Posted On2016-04-15