Incidental Mutation 'R4920:Dennd3'
ID378530
Institutional Source Beutler Lab
Gene Symbol Dennd3
Ensembl Gene ENSMUSG00000036661
Gene NameDENN/MADD domain containing 3
SynonymsE030003N15Rik
MMRRC Submission 042522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R4920 (G1)
Quality Score209
Status Validated
Chromosome15
Chromosomal Location73512560-73572242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73540725 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 412 (H412R)
Ref Sequence ENSEMBL: ENSMUSP00000134002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043414] [ENSMUST00000173292]
Predicted Effect probably benign
Transcript: ENSMUST00000043414
AA Change: H412R

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046774
Gene: ENSMUSG00000036661
AA Change: H412R

DomainStartEndE-ValueType
Blast:uDENN 12 161 3e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
WD40 1232 1272 1.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162488
SMART Domains Protein: ENSMUSP00000125657
Gene: ENSMUSG00000036661

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:DENN 33 104 5e-28 BLAST
DENN 116 302 1.54e-62 SMART
dDENN 312 376 5.63e-6 SMART
WD40 892 931 3.68e1 SMART
WD40 934 975 3.32e-5 SMART
WD40 1109 1149 1.1e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173292
AA Change: H412R

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134002
Gene: ENSMUSG00000036661
AA Change: H412R

DomainStartEndE-ValueType
Blast:uDENN 12 161 2e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092K14Rik A T 11: 114,199,045 noncoding transcript Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Apbb1ip A G 2: 22,819,684 D51G unknown Het
Arntl A G 7: 113,285,114 T120A probably damaging Het
Brca1 A T 11: 101,524,959 V783D probably damaging Het
Ccdc141 T C 2: 77,168,563 D58G probably damaging Het
Ccr9 G T 9: 123,779,439 G62V probably damaging Het
Ces2b T C 8: 104,836,906 Y422H probably benign Het
Cpa4 T C 6: 30,568,463 probably null Het
Dpy19l3 A T 7: 35,708,042 probably benign Het
Dtwd2 G T 18: 49,698,440 R167S possibly damaging Het
Dync1i2 G A 2: 71,247,324 R243Q probably damaging Het
Ear2 G A 14: 44,103,125 G80E probably damaging Het
Fam171b A G 2: 83,880,359 K792E possibly damaging Het
Fam83b G A 9: 76,491,868 T651I probably benign Het
Fcrl5 T G 3: 87,444,173 F243V probably damaging Het
Galntl6 T C 8: 58,427,773 I115M probably damaging Het
Glrx3 A G 7: 137,464,130 D163G probably null Het
Gm13089 T C 4: 143,699,283 D30G probably benign Het
Gm14488 A T 2: 30,715,032 noncoding transcript Het
Gm973 T C 1: 59,627,566 S683P probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Gsdmd T C 15: 75,864,357 S112P probably damaging Het
Ighv14-3 A G 12: 114,060,257 V6A probably benign Het
Lca5l T A 16: 96,178,835 S32C probably damaging Het
Lrba T A 3: 86,664,458 Y260* probably null Het
Lyst T C 13: 13,647,060 S1340P possibly damaging Het
Mfsd13a T G 19: 46,367,216 F59V probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Noa1 T C 5: 77,306,487 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Papd4 G A 13: 93,186,325 Q39* probably null Het
Pgm2 C T 4: 99,986,733 T571M probably damaging Het
Rfc1 C A 5: 65,287,928 V460F probably damaging Het
Rrn3 A G 16: 13,790,639 D182G probably benign Het
Sap25 T A 5: 137,642,245 probably benign Het
Slc9a2 A G 1: 40,755,718 I480V probably benign Het
Smo T C 6: 29,759,594 S642P probably damaging Het
Tbc1d22a A C 15: 86,311,748 I307L probably benign Het
Ubr3 A G 2: 69,952,868 Q716R probably benign Het
Vmn2r96 A G 17: 18,582,656 E276G probably benign Het
Zfp189 G A 4: 49,529,302 C135Y probably damaging Het
Other mutations in Dennd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd3 APN 15 73567133 missense probably benign 0.26
IGL00579:Dennd3 APN 15 73540842 missense possibly damaging 0.63
IGL02101:Dennd3 APN 15 73527945 missense possibly damaging 0.81
IGL02164:Dennd3 APN 15 73544448 missense probably benign 0.26
IGL02389:Dennd3 APN 15 73567056 missense probably damaging 1.00
IGL02604:Dennd3 APN 15 73556403 missense probably damaging 1.00
IGL02697:Dennd3 APN 15 73524236 missense possibly damaging 0.82
IGL02885:Dennd3 APN 15 73568696 missense probably benign
IGL03356:Dennd3 APN 15 73568633 missense probably benign 0.19
IGL03388:Dennd3 APN 15 73544359 missense probably damaging 0.98
R0118:Dennd3 UTSW 15 73565076 missense probably damaging 1.00
R0925:Dennd3 UTSW 15 73533435 missense probably damaging 1.00
R1076:Dennd3 UTSW 15 73540733 missense probably damaging 1.00
R1355:Dennd3 UTSW 15 73540854 splice site probably benign
R1370:Dennd3 UTSW 15 73540854 splice site probably benign
R1480:Dennd3 UTSW 15 73532846 missense probably benign 0.20
R1727:Dennd3 UTSW 15 73565128 missense possibly damaging 0.95
R1732:Dennd3 UTSW 15 73537418 splice site probably benign
R1771:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1776:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1779:Dennd3 UTSW 15 73522508 critical splice donor site probably null
R1838:Dennd3 UTSW 15 73565100 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73523496 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2147:Dennd3 UTSW 15 73523487 missense probably damaging 1.00
R2148:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2149:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2150:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2174:Dennd3 UTSW 15 73555305 missense probably damaging 1.00
R2295:Dennd3 UTSW 15 73523555 critical splice donor site probably null
R2905:Dennd3 UTSW 15 73557646 missense probably damaging 1.00
R3106:Dennd3 UTSW 15 73565124 nonsense probably null
R3757:Dennd3 UTSW 15 73522234 missense probably benign 0.00
R3785:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3786:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3787:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3847:Dennd3 UTSW 15 73542732 missense possibly damaging 0.64
R4369:Dennd3 UTSW 15 73540809 missense probably damaging 0.98
R4601:Dennd3 UTSW 15 73567160 missense probably damaging 0.99
R4666:Dennd3 UTSW 15 73570860 missense probably damaging 1.00
R4680:Dennd3 UTSW 15 73533376 missense possibly damaging 0.82
R4708:Dennd3 UTSW 15 73523495 missense probably damaging 1.00
R4789:Dennd3 UTSW 15 73522282 missense probably damaging 1.00
R5043:Dennd3 UTSW 15 73527936 missense probably benign 0.00
R5074:Dennd3 UTSW 15 73547295 missense probably damaging 1.00
R5410:Dennd3 UTSW 15 73547448 missense probably benign 0.02
R5421:Dennd3 UTSW 15 73567115 missense probably benign
R5560:Dennd3 UTSW 15 73532895 missense probably damaging 1.00
R6008:Dennd3 UTSW 15 73567080 missense possibly damaging 0.88
R6357:Dennd3 UTSW 15 73556472 missense possibly damaging 0.49
R6563:Dennd3 UTSW 15 73544380 missense probably damaging 0.98
R6687:Dennd3 UTSW 15 73556366 missense possibly damaging 0.64
R6837:Dennd3 UTSW 15 73557693 missense probably damaging 1.00
R6910:Dennd3 UTSW 15 73555116 missense probably benign 0.01
R7125:Dennd3 UTSW 15 73533291 missense possibly damaging 0.50
R7297:Dennd3 UTSW 15 73557610 missense probably damaging 1.00
R7524:Dennd3 UTSW 15 73524246 nonsense probably null
R7580:Dennd3 UTSW 15 73556447 missense possibly damaging 0.89
R7653:Dennd3 UTSW 15 73562426 missense probably damaging 0.99
R7731:Dennd3 UTSW 15 73562367 missense probably damaging 0.99
R7767:Dennd3 UTSW 15 73522230 missense probably benign
R7806:Dennd3 UTSW 15 73570775 missense possibly damaging 0.87
R7860:Dennd3 UTSW 15 73540808 missense probably damaging 0.97
R7943:Dennd3 UTSW 15 73540808 missense probably damaging 0.97
RF006:Dennd3 UTSW 15 73547592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTGGGTCTGAAGCGAG -3'
(R):5'- CTGCTGCACTTGTCATGAGG -3'

Sequencing Primer
(F):5'- AGCGAGGCCTTCATGTGGTAAC -3'
(R):5'- CTGCACTTGTCATGAGGAAAGGC -3'
Posted On2016-04-15