Incidental Mutation 'R4921:Cntn2'
ID378539
Institutional Source Beutler Lab
Gene Symbol Cntn2
Ensembl Gene ENSMUSG00000053024
Gene Namecontactin 2
Synonymsaxonin, Tax, TAG-1, D130012K04Rik
MMRRC Submission 042523-MU
Accession Numbers

Ncbi RefSeq: NM_177129.5; MGI:104518

Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132509427-132543256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132516032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1003 (V1003E)
Ref Sequence ENSEMBL: ENSMUSP00000083707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086521]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086521
AA Change: V1003E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024
AA Change: V1003E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect unknown
Transcript: ENSMUST00000188065
AA Change: V506E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188143
Predicted Effect probably benign
Transcript: ENSMUST00000189528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype Strain: 2181052; 2677610; 3521785
FUNCTION: This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. Mice lacking a functional copy of this gene exhibit epileptic seizures and elevated expression of A1 adenosine receptors. [provided by RefSeq, Sep 2016]
PHENOTYPE: Targeted mutation of this locus results in molecular abnormalities in the central nervous system. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Cntn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Cntn2 APN 1 132521884 splice site probably benign
IGL01137:Cntn2 APN 1 132521297 splice site probably benign
IGL01339:Cntn2 APN 1 132518905 splice site probably null
IGL01369:Cntn2 APN 1 132516105 missense probably benign
IGL01572:Cntn2 APN 1 132528171 missense probably damaging 1.00
IGL02389:Cntn2 APN 1 132525321 missense probably damaging 0.99
IGL02473:Cntn2 APN 1 132518331 missense probably benign
IGL02550:Cntn2 APN 1 132529063 missense probably null 0.03
IGL02608:Cntn2 APN 1 132525916 missense possibly damaging 0.87
IGL02755:Cntn2 APN 1 132529302 missense probably benign 0.43
IGL02850:Cntn2 APN 1 132518376 missense probably benign 0.00
IGL02887:Cntn2 APN 1 132516570 missense probably damaging 0.96
IGL03060:Cntn2 APN 1 132528940 missense probably benign 0.03
IGL03224:Cntn2 APN 1 132523042 missense probably damaging 1.00
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0270:Cntn2 UTSW 1 132521724 missense probably damaging 1.00
R0739:Cntn2 UTSW 1 132529012 missense probably damaging 1.00
R0849:Cntn2 UTSW 1 132522386 missense probably benign 0.09
R0903:Cntn2 UTSW 1 132533684 small deletion probably benign
R1463:Cntn2 UTSW 1 132521137 critical splice donor site probably null
R1512:Cntn2 UTSW 1 132523692 missense probably damaging 0.99
R1535:Cntn2 UTSW 1 132525384 missense probably benign 0.26
R1686:Cntn2 UTSW 1 132526311 missense possibly damaging 0.78
R1696:Cntn2 UTSW 1 132521279 missense probably damaging 0.96
R1708:Cntn2 UTSW 1 132519198 missense probably damaging 0.96
R2251:Cntn2 UTSW 1 132525321 missense probably damaging 0.99
R2315:Cntn2 UTSW 1 132522997 missense probably benign 0.00
R2395:Cntn2 UTSW 1 132526372 missense probably benign
R3617:Cntn2 UTSW 1 132528623 missense probably benign 0.16
R3883:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R3884:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R4060:Cntn2 UTSW 1 132525896 missense probably damaging 0.99
R4289:Cntn2 UTSW 1 132527743 missense probably benign 0.01
R4710:Cntn2 UTSW 1 132528225 missense possibly damaging 0.84
R5121:Cntn2 UTSW 1 132517060 nonsense probably null
R5288:Cntn2 UTSW 1 132523677 missense probably benign 0.18
R5360:Cntn2 UTSW 1 132518857 missense probably damaging 0.97
R5787:Cntn2 UTSW 1 132523059 missense probably damaging 1.00
R5817:Cntn2 UTSW 1 132518748 missense probably benign 0.21
R5930:Cntn2 UTSW 1 132523432 missense probably damaging 1.00
R6053:Cntn2 UTSW 1 132518352 missense probably benign 0.18
R7189:Cntn2 UTSW 1 132517086 missense probably damaging 1.00
R7352:Cntn2 UTSW 1 132522399 missense probably benign 0.02
R7562:Cntn2 UTSW 1 132526317 missense possibly damaging 0.67
R7689:Cntn2 UTSW 1 132516144 missense probably benign 0.00
R7764:Cntn2 UTSW 1 132522363 missense probably benign 0.21
X0018:Cntn2 UTSW 1 132533684 small deletion probably benign
Z1176:Cntn2 UTSW 1 132527788 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATGGCACCATTCATTG -3'
(R):5'- TGGTGAGCTTGACCAATGAG -3'

Sequencing Primer
(F):5'- GCACCATTCATTGCCTGTC -3'
(R):5'- AGGAGGCTCCATCTGGAAACTTC -3'
Posted On2016-04-15