Mutagenetix > Incidental Mutation

Incidental Mutation 'R4921:Cntn2'

378539

Institutional Source

Beutler Lab

Gene Symbol

Cntn2

Ensembl Gene

ENSMUSG00000053024

Gene Name

contactin 2

Synonyms

axonin, Tax, TAG-1, D130012K04Rik

MMRRC Submission

042523-MU

Accession Numbers

Ncbi RefSeq: NM_177129.5; MGI:104518

Is this an essential gene?

Possibly non essential (E-score: 0.303) question?

Stock #

R4921 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

132509427-132543256 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 132516032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1003 (V1003E)

Ref Sequence

ENSEMBL: ENSMUSP00000083707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086521]

AlphaFold

Q61330

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086521
AA Change: V1003E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024
AA Change: V1003E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
IGc2	54	120	8.78e-9	SMART
IG	142	232	3.89e-1	SMART
IGc2	254	315	2.14e-21	SMART
IGc2	341	404	4.59e-12	SMART
IGc2	433	497	7.52e-8	SMART
IGc2	523	596	2.72e-5	SMART
FN3	610	696	2.72e-12	SMART
FN3	713	799	1.02e-2	SMART
FN3	815	899	5.27e-10	SMART
FN3	915	995	8.91e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186487

Predicted Effect

unknown
Transcript: ENSMUST00000188065
AA Change: V506E

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188143

Predicted Effect

probably benign
Transcript: ENSMUST00000189528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190601

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.3%

Validation Efficiency

MGI Phenotype

Strain: 2181052; 2677610; 3521785
FUNCTION: This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. Mice lacking a functional copy of this gene exhibit epileptic seizures and elevated expression of A1 adenosine receptors. [provided by RefSeq, Sep 2016]
PHENOTYPE: Targeted mutation of this locus results in molecular abnormalities in the central nervous system. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,796	N65K	probably benign	Het
Abcc9	T	C	6: 142,590,436	Y1524C	probably benign	Het
Acap1	A	G	11: 69,887,193	I102T	probably damaging	Het
Acvr2a	T	C	2: 48,893,541	V284A	possibly damaging	Het
Adam3	T	C	8: 24,684,614	M712V	probably benign	Het
Adck1	T	C	12: 88,441,138	V213A	probably benign	Het
Adgrl3	G	T	5: 81,512,110	W242L	probably damaging	Het
Alk	T	C	17: 71,904,315	T857A	probably benign	Het
Alms1	A	G	6: 85,628,546	T2393A	probably benign	Het
Ank3	C	T	10: 70,002,109	P240L	probably damaging	Het
Ankrd35	C	A	3: 96,684,824	L809M	possibly damaging	Het
Birc6	T	A	17: 74,650,099	L3690Q	probably damaging	Het
Bmp3	C	A	5: 98,872,061	F114L	probably damaging	Het
Cage1	G	A	13: 38,019,208	H627Y	probably benign	Het
Cars	T	C	7: 143,569,475	D468G	probably damaging	Het
Ccdc148	T	C	2: 58,829,802	E487G	probably damaging	Het
Ccdc80	A	T	16: 45,118,167	I746F	probably damaging	Het
Ccl25	A	G	8: 4,353,913	Q119R	possibly damaging	Het
Cdh24	C	T	14: 54,633,215	D178N	probably damaging	Het
Cdk12	A	T	11: 98,222,687	T766S	unknown	Het
Chst15	T	A	7: 132,247,884	T443S	probably benign	Het
Cnbp	T	C	6: 87,845,146	D125G	possibly damaging	Het
Crct1	A	G	3: 93,014,825		probably benign	Het
Dand5	C	T	8: 84,816,484	C121Y	probably damaging	Het
Dmkn	A	T	7: 30,771,233	D382V	probably damaging	Het
Dnase2b	T	A	3: 146,593,441	T86S	probably damaging	Het
Dusp8	GCCACCACCACCACCACCACCACC	GCCACCACCACCACCACCACC	7: 142,082,154		probably benign	Het
Eef1akmt1	C	T	14: 57,550,632	V90M	probably damaging	Het
Egfl7	G	T	2: 26,590,980	W168L	probably benign	Het
Ep400	A	G	5: 110,665,810	C2908R	probably damaging	Het
Espl1	A	G	15: 102,315,241	K1076E	probably damaging	Het
Exoc4	A	G	6: 33,910,517	N747D	probably benign	Het
Fancm	T	C	12: 65,077,141	V191A	probably benign	Het
Fbxo17	A	G	7: 28,732,789	D97G	probably benign	Het
Fer1l6	G	T	15: 58,600,311		probably null	Het
Flt4	T	C	11: 49,627,143	W337R	probably damaging	Het
Fpr-rs7	T	C	17: 20,113,820	H136R	possibly damaging	Het
Frem3	T	A	8: 80,613,136	I686N	possibly damaging	Het
Galnt9	A	G	5: 110,577,449	K84R	probably damaging	Het
Gfm2	T	A	13: 97,175,676	M760K	probably damaging	Het
Glis3	T	C	19: 28,666,104	T13A	probably damaging	Het
Gm13078	A	T	4: 143,728,326	K398M	possibly damaging	Het
H2-K1	A	G	17: 33,997,076	V323A	possibly damaging	Het
Hbb-bs	G	A	7: 103,826,720	A130V	probably damaging	Het
Herc2	T	A	7: 56,229,690	H4685Q	probably benign	Het
Ighv5-9-1	C	T	12: 113,736,294	R56H	possibly damaging	Het
Itgb4	A	G	11: 116,006,605	N1548S	probably benign	Het
Itpr3	T	C	17: 27,098,005	Y745H	probably damaging	Het
Kank3	G	T	17: 33,817,200	G14V	probably damaging	Het
Kif24	G	T	4: 41,394,329	S982Y	probably damaging	Het
Kifc5b	C	T	17: 26,921,023	R53W	probably damaging	Het
Krt39	A	G	11: 99,514,749	S442P	possibly damaging	Het
Lcat	G	A	8: 105,942,442	P67L	possibly damaging	Het
Maml2	T	C	9: 13,621,175	S562P	probably damaging	Het
Map3k8	G	A	18: 4,349,124	R65W	possibly damaging	Het
Mbd3	G	T	10: 80,395,576	R12S	probably damaging	Het
Msr1	T	C	8: 39,624,251	E106G	possibly damaging	Het
Myh4	T	A	11: 67,254,028	L1256Q	probably damaging	Het
Mypn	G	A	10: 63,147,936	T511M	possibly damaging	Het
Nub1	A	T	5: 24,701,469	N331I	probably benign	Het
Nup107	A	G	10: 117,770,511	V440A	possibly damaging	Het
Ofcc1	A	G	13: 40,214,517	F174L	probably benign	Het
Olfr1497	T	C	19: 13,795,465	I49V	probably benign	Het
Olfr597	A	T	7: 103,320,543	N44I	probably damaging	Het
Olfr975	A	C	9: 39,950,225	V182G	probably damaging	Het
Parp2	C	A	14: 50,819,268	L310I	probably damaging	Het
Pcdh20	A	G	14: 88,469,726	V46A	probably benign	Het
Pcdhgb6	A	G	18: 37,743,472	D411G	probably damaging	Het
Pkd1l2	T	C	8: 117,054,885	E807G	probably benign	Het
Pkd1l2	A	T	8: 117,072,549	N267K	probably damaging	Het
Rell1	C	A	5: 63,936,033	M126I	probably damaging	Het
Robo4	G	A	9: 37,402,560	E36K	probably benign	Het
Rpgrip1l	T	C	8: 91,261,009	S807G	probably benign	Het
Rpl10a	T	C	17: 28,330,852	V169A	probably benign	Het
Rubcn	C	T	16: 32,847,294	V166I	probably damaging	Het
Sall2	T	C	14: 52,315,393	E113G	possibly damaging	Het
Sars2	T	C	7: 28,752,438	S423P	possibly damaging	Het
Scaper	A	G	9: 55,892,235	I182T	probably benign	Het
Selp	A	G	1: 164,141,397	D522G	possibly damaging	Het
Sema4b	T	A	7: 80,198,756	I35N	possibly damaging	Het
Sgce	A	T	6: 4,694,153	F268I	probably damaging	Het
Slc14a2	G	T	18: 78,192,188	A258E	probably damaging	Het
Slc17a9	T	C	2: 180,735,949	Y213H	probably benign	Het
Slc22a7	T	G	17: 46,436,933	I233L	probably benign	Het
Slc35f1	A	G	10: 53,062,602	Q210R	probably damaging	Het
Slc6a21	A	G	7: 45,288,310	E350G	possibly damaging	Het
Spata21	A	T	4: 141,112,091	D639V	probably damaging	Het
Svil	A	G	18: 5,108,631	D1519G	probably damaging	Het
Tbccd1	T	C	16: 22,841,899	T56A	probably benign	Het
Tigit	A	T	16: 43,662,017	I118N	probably damaging	Het
Tlr11	A	T	14: 50,362,885	Q776L	possibly damaging	Het
Tspan12	A	C	6: 21,835,449	I9S	possibly damaging	Het
Unc5c	T	A	3: 141,788,966	Y347N	probably damaging	Het
Unk	A	G	11: 116,054,945	T481A	probably benign	Het
Vmn1r192	A	C	13: 22,187,480	V190G	probably damaging	Het
Vnn3	A	T	10: 23,864,575	M259L	probably benign	Het
Zan	T	C	5: 137,408,370		probably benign	Het
Zdhhc6	T	C	19: 55,313,210	H113R	probably damaging	Het

Other mutations in Cntn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01106:Cntn2	APN	1	132521884	splice site	probably benign
IGL01137:Cntn2	APN	1	132521297	splice site	probably benign
IGL01339:Cntn2	APN	1	132518905	splice site	probably null
IGL01369:Cntn2	APN	1	132516105	missense	probably benign
IGL01572:Cntn2	APN	1	132528171	missense	probably damaging	1.00
IGL02389:Cntn2	APN	1	132525321	missense	probably damaging	0.99
IGL02473:Cntn2	APN	1	132518331	missense	probably benign
IGL02550:Cntn2	APN	1	132529063	missense	probably null	0.03
IGL02608:Cntn2	APN	1	132525916	missense	possibly damaging	0.87
IGL02755:Cntn2	APN	1	132529302	missense	probably benign	0.43
IGL02850:Cntn2	APN	1	132518376	missense	probably benign	0.00
IGL02887:Cntn2	APN	1	132516570	missense	probably damaging	0.96
IGL03060:Cntn2	APN	1	132528940	missense	probably benign	0.03
IGL03224:Cntn2	APN	1	132523042	missense	probably damaging	1.00
R0009:Cntn2	UTSW	1	132516180	nonsense	probably null
R0009:Cntn2	UTSW	1	132516180	nonsense	probably null
R0270:Cntn2	UTSW	1	132521724	missense	probably damaging	1.00
R0739:Cntn2	UTSW	1	132529012	missense	probably damaging	1.00
R0849:Cntn2	UTSW	1	132522386	missense	probably benign	0.09
R0903:Cntn2	UTSW	1	132533684	small deletion	probably benign
R1463:Cntn2	UTSW	1	132521137	critical splice donor site	probably null
R1512:Cntn2	UTSW	1	132523692	missense	probably damaging	0.99
R1535:Cntn2	UTSW	1	132525384	missense	probably benign	0.26
R1686:Cntn2	UTSW	1	132526311	missense	possibly damaging	0.78
R1696:Cntn2	UTSW	1	132521279	missense	probably damaging	0.96
R1708:Cntn2	UTSW	1	132519198	missense	probably damaging	0.96
R2251:Cntn2	UTSW	1	132525321	missense	probably damaging	0.99
R2315:Cntn2	UTSW	1	132522997	missense	probably benign	0.00
R2395:Cntn2	UTSW	1	132526372	missense	probably benign
R3617:Cntn2	UTSW	1	132528623	missense	probably benign	0.16
R3883:Cntn2	UTSW	1	132528939	missense	probably damaging	0.99
R3884:Cntn2	UTSW	1	132528939	missense	probably damaging	0.99
R4060:Cntn2	UTSW	1	132525896	missense	probably damaging	0.99
R4289:Cntn2	UTSW	1	132527743	missense	probably benign	0.01
R4710:Cntn2	UTSW	1	132528225	missense	possibly damaging	0.84
R5121:Cntn2	UTSW	1	132517060	nonsense	probably null
R5288:Cntn2	UTSW	1	132523677	missense	probably benign	0.18
R5360:Cntn2	UTSW	1	132518857	missense	probably damaging	0.97
R5787:Cntn2	UTSW	1	132523059	missense	probably damaging	1.00
R5817:Cntn2	UTSW	1	132518748	missense	probably benign	0.21
R5930:Cntn2	UTSW	1	132523432	missense	probably damaging	1.00
R6053:Cntn2	UTSW	1	132518352	missense	probably benign	0.18
R7189:Cntn2	UTSW	1	132517086	missense	probably damaging	1.00
R7352:Cntn2	UTSW	1	132522399	missense	probably benign	0.02
R7562:Cntn2	UTSW	1	132526317	missense	possibly damaging	0.67
R7689:Cntn2	UTSW	1	132516144	missense	probably benign	0.00
R7764:Cntn2	UTSW	1	132522363	missense	probably benign	0.21
R8080:Cntn2	UTSW	1	132521798	missense	probably damaging	1.00
R8344:Cntn2	UTSW	1	132521774	missense	probably damaging	1.00
R8683:Cntn2	UTSW	1	132522993	missense	probably damaging	1.00
R9087:Cntn2	UTSW	1	132525370	missense	probably damaging	1.00
R9188:Cntn2	UTSW	1	132515538	missense	probably damaging	1.00
R9267:Cntn2	UTSW	1	132521283	missense	probably benign	0.02
R9329:Cntn2	UTSW	1	132528940	missense	probably benign	0.03
R9385:Cntn2	UTSW	1	132528174	missense	probably damaging	1.00
X0018:Cntn2	UTSW	1	132533684	small deletion	probably benign
Z1176:Cntn2	UTSW	1	132527788	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCATGGCACCATTCATTG -3'
(R):5'- TGGTGAGCTTGACCAATGAG -3'

Sequencing Primer
(F):5'- GCACCATTCATTGCCTGTC -3'
(R):5'- AGGAGGCTCCATCTGGAAACTTC -3'

Posted On

2016-04-15