Incidental Mutation 'R4921:Selp'
ID378540
Institutional Source Beutler Lab
Gene Symbol Selp
Ensembl Gene ENSMUSG00000026580
Gene Nameselectin, platelet
SynonymsGrmp, CD62P, P-selectin
MMRRC Submission 042523-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location164115264-164150026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164141397 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 522 (D522G)
Ref Sequence ENSEMBL: ENSMUSP00000123924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162746]
PDB Structure
Structure of the SNX17 atypical FERM domain bound to the NPxY motif of P-selectin [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161020
Predicted Effect probably benign
Transcript: ENSMUST00000161152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161943
Predicted Effect possibly damaging
Transcript: ENSMUST00000162746
AA Change: D522G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123924
Gene: ENSMUSG00000026580
AA Change: D522G

DomainStartEndE-ValueType
CLECT 30 159 2.89e-16 SMART
EGF 162 195 1.97e-4 SMART
CCP 200 257 1.31e-14 SMART
CCP 262 319 4.02e-15 SMART
CCP 324 381 5.91e-13 SMART
CCP 386 443 1.46e-12 SMART
CCP 448 505 3.9e-13 SMART
CCP 510 567 1.95e-13 SMART
CCP 580 637 1.97e-9 SMART
CCP 642 699 3.9e-13 SMART
transmembrane domain 711 733 N/A INTRINSIC
PDB:4GXB|B 741 768 2e-12 PDB
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mildly attenuated inflammatory responses, increased numbers of circulating neutrophils, lack of leukocyte rolling in mesenteric venules, and increased survival after Plasmodium berghei infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Selp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Selp APN 1 164143892 critical splice acceptor site probably null
IGL02430:Selp APN 1 164126383 missense probably damaging 1.00
IGL02591:Selp APN 1 164130133 missense probably damaging 1.00
IGL02883:Selp APN 1 164130102 missense probably benign 0.00
IGL02945:Selp APN 1 164133929 missense probably damaging 1.00
PIT4812001:Selp UTSW 1 164132263 missense probably benign 0.29
R1571:Selp UTSW 1 164126607 missense probably damaging 1.00
R1731:Selp UTSW 1 164141440 nonsense probably null
R1758:Selp UTSW 1 164132285 missense possibly damaging 0.64
R1834:Selp UTSW 1 164128160 splice site probably null
R1951:Selp UTSW 1 164126512 missense probably benign 0.36
R1953:Selp UTSW 1 164126512 missense probably benign 0.36
R1987:Selp UTSW 1 164142758 missense probably damaging 0.98
R2244:Selp UTSW 1 164137286 nonsense probably null
R2484:Selp UTSW 1 164143954 missense probably benign 0.43
R2484:Selp UTSW 1 164143955 missense probably damaging 1.00
R3440:Selp UTSW 1 164123775 missense probably benign 0.17
R3831:Selp UTSW 1 164132280 nonsense probably null
R3958:Selp UTSW 1 164126286 missense probably benign 0.03
R4795:Selp UTSW 1 164144906 missense probably benign 0.15
R4796:Selp UTSW 1 164144906 missense probably benign 0.15
R4807:Selp UTSW 1 164143936 missense probably damaging 1.00
R4832:Selp UTSW 1 164126340 missense probably damaging 1.00
R4917:Selp UTSW 1 164144906 missense probably damaging 0.99
R5399:Selp UTSW 1 164126586 missense possibly damaging 0.93
R5734:Selp UTSW 1 164143891 splice site probably benign
R5752:Selp UTSW 1 164137242 missense probably damaging 1.00
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6185:Selp UTSW 1 164126346 missense probably damaging 1.00
R6555:Selp UTSW 1 164141602 intron probably null
R6955:Selp UTSW 1 164144909 missense possibly damaging 0.94
R7106:Selp UTSW 1 164126422 missense probably benign 0.12
R7677:Selp UTSW 1 164133956 missense probably damaging 1.00
R7831:Selp UTSW 1 164145015 critical splice donor site probably null
R7914:Selp UTSW 1 164145015 critical splice donor site probably null
Z1176:Selp UTSW 1 164126432 missense probably benign 0.00
Z1177:Selp UTSW 1 164144898 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCCCGAGATACAGTCAGTAATC -3'
(R):5'- AGCTTTCTGTTAGCATCAGGG -3'

Sequencing Primer
(F):5'- GGCATTTCCTCAACTGAAGC -3'
(R):5'- GCTTTCTGTTAGCATCAGGGAAAAAC -3'
Posted On2016-04-15