Incidental Mutation 'R4921:Sgce'
ID378567
Institutional Source Beutler Lab
Gene Symbol Sgce
Ensembl Gene ENSMUSG00000004631
Gene Namesarcoglycan, epsilon
Synonymse-SG
MMRRC Submission 042523-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location4674350-4747207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4694153 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 268 (F268I)
Ref Sequence ENSEMBL: ENSMUSP00000111240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004750] [ENSMUST00000090686] [ENSMUST00000101677] [ENSMUST00000115577] [ENSMUST00000115579] [ENSMUST00000126151] [ENSMUST00000133306]
Predicted Effect probably damaging
Transcript: ENSMUST00000004750
AA Change: F232I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004750
Gene: ENSMUSG00000004631
AA Change: F232I

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090686
AA Change: F232I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088185
Gene: ENSMUSG00000004631
AA Change: F232I

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101677
AA Change: F232I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099200
Gene: ENSMUSG00000004631
AA Change: F232I

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115577
AA Change: F268I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111240
Gene: ENSMUSG00000004631
AA Change: F268I

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
CADG 85 193 1.86e-10 SMART
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115579
AA Change: F232I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111242
Gene: ENSMUSG00000004631
AA Change: F232I

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123907
SMART Domains Protein: ENSMUSP00000120910
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 32 140 1.86e-10 SMART
low complexity region 395 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126151
AA Change: F191I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120718
Gene: ENSMUSG00000004631
AA Change: F191I

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 389 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128109
Predicted Effect probably damaging
Transcript: ENSMUST00000133306
AA Change: F232I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121964
Gene: ENSMUSG00000004631
AA Change: F232I

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 398 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153284
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele display significantly increased myoclonus and deficits in motor coordination and balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Sgce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Sgce APN 6 4689750 missense probably damaging 1.00
IGL01399:Sgce APN 6 4746997 missense probably damaging 1.00
IGL01796:Sgce APN 6 4711326 missense probably damaging 1.00
IGL02403:Sgce APN 6 4694059 missense probably damaging 1.00
IGL02421:Sgce APN 6 4694187 splice site probably benign
IGL02547:Sgce APN 6 4711301 splice site probably benign
IGL02585:Sgce APN 6 4711388 splice site probably benign
IGL03355:Sgce APN 6 4689738 missense probably damaging 1.00
IGL03374:Sgce APN 6 4689718 nonsense probably null
PIT4445001:Sgce UTSW 6 4689654 missense possibly damaging 0.85
R0345:Sgce UTSW 6 4718019 missense probably damaging 1.00
R0611:Sgce UTSW 6 4689621 missense probably damaging 1.00
R0719:Sgce UTSW 6 4689753 missense probably damaging 1.00
R1162:Sgce UTSW 6 4691419 splice site probably benign
R1630:Sgce UTSW 6 4719476 missense probably damaging 0.98
R1694:Sgce UTSW 6 4689709 missense probably damaging 1.00
R1759:Sgce UTSW 6 4689765 missense probably damaging 1.00
R1897:Sgce UTSW 6 4691511 missense probably benign 0.00
R2231:Sgce UTSW 6 4730066 missense probably benign 0.44
R3429:Sgce UTSW 6 4730008 missense probably benign 0.01
R4011:Sgce UTSW 6 4691563 nonsense probably null
R4426:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4427:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4651:Sgce UTSW 6 4689560 intron probably benign
R4652:Sgce UTSW 6 4689560 intron probably benign
R4974:Sgce UTSW 6 4689630 missense probably benign 0.00
R6271:Sgce UTSW 6 4730015 missense possibly damaging 0.81
R6898:Sgce UTSW 6 4689666 missense probably damaging 1.00
R7317:Sgce UTSW 6 4691615 missense probably benign 0.00
R7347:Sgce UTSW 6 4694106 missense probably damaging 1.00
R7512:Sgce UTSW 6 4707192 missense possibly damaging 0.75
R7671:Sgce UTSW 6 4691564 missense probably damaging 1.00
R8009:Sgce UTSW 6 4691636 missense probably damaging 0.99
X0026:Sgce UTSW 6 4689638 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GGTTCCAGTCAAATGGTATGTC -3'
(R):5'- CCAGGCTCCTATCTCAGAGATG -3'

Sequencing Primer
(F):5'- TGGTATGTCCAGACACATCACTG -3'
(R):5'- GAGATGACTCTAGTTAAGCCCTC -3'
Posted On2016-04-15