Incidental Mutation 'R4921:Cars'
ID378585
Institutional Source Beutler Lab
Gene Symbol Cars
Ensembl Gene ENSMUSG00000010755
Gene Namecysteinyl-tRNA synthetase
SynonymsCA3
MMRRC Submission 042523-MU
Accession Numbers

Genbank: NM_013742

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location143557230-143600090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143569475 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 468 (D468G)
Ref Sequence ENSEMBL: ENSMUSP00000101529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010899] [ENSMUST00000105909]
Predicted Effect probably damaging
Transcript: ENSMUST00000010899
AA Change: D551G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010899
Gene: ENSMUSG00000010755
AA Change: D551G

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 124 537 2.7e-128 PFAM
Blast:DALR_2 584 644 2e-13 BLAST
coiled coil region 728 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105909
AA Change: D468G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101529
Gene: ENSMUSG00000010755
AA Change: D468G

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 41 454 2e-129 PFAM
Pfam:tRNA-synt_1g 387 465 1.2e-6 PFAM
Blast:DALR_2 501 561 1e-13 BLAST
coiled coil region 645 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184553
Predicted Effect probably benign
Transcript: ENSMUST00000208575
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(37) : Targeted, other(2) Gene trapped(35)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Cars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Cars APN 7 143569849 missense probably benign 0.03
IGL02192:Cars APN 7 143571588 missense probably damaging 1.00
IGL02645:Cars APN 7 143557909 missense probably damaging 0.97
IGL02807:Cars APN 7 143569472 missense possibly damaging 0.87
IGL02860:Cars APN 7 143586421 missense probably damaging 1.00
IGL03005:Cars APN 7 143559169 missense probably damaging 1.00
vroom UTSW 7 143570648 missense probably damaging 1.00
F5493:Cars UTSW 7 143569871 missense probably damaging 1.00
R0358:Cars UTSW 7 143588482 splice site probably benign
R0452:Cars UTSW 7 143592625 nonsense probably null
R0717:Cars UTSW 7 143584755 missense probably damaging 0.98
R0930:Cars UTSW 7 143570570 missense probably damaging 1.00
R1069:Cars UTSW 7 143570107 missense probably benign 0.40
R1184:Cars UTSW 7 143587139 missense probably damaging 1.00
R1503:Cars UTSW 7 143568989 missense probably benign 0.04
R1755:Cars UTSW 7 143569457 missense probably damaging 1.00
R1762:Cars UTSW 7 143592474 missense probably damaging 1.00
R1783:Cars UTSW 7 143592474 missense probably damaging 1.00
R1786:Cars UTSW 7 143592474 missense probably damaging 1.00
R1828:Cars UTSW 7 143576648 missense probably damaging 0.97
R2084:Cars UTSW 7 143587182 missense probably benign 0.03
R2132:Cars UTSW 7 143592474 missense probably damaging 1.00
R2133:Cars UTSW 7 143592474 missense probably damaging 1.00
R2397:Cars UTSW 7 143592507 missense possibly damaging 0.61
R4012:Cars UTSW 7 143559674 missense possibly damaging 0.65
R4057:Cars UTSW 7 143570648 missense probably damaging 1.00
R4082:Cars UTSW 7 143569497 missense probably damaging 1.00
R4118:Cars UTSW 7 143559647 critical splice donor site probably null
R4527:Cars UTSW 7 143565049 missense probably benign 0.22
R4663:Cars UTSW 7 143575960 missense probably damaging 1.00
R4758:Cars UTSW 7 143571567 missense probably benign 0.01
R4820:Cars UTSW 7 143570564 missense probably damaging 1.00
R4923:Cars UTSW 7 143569850 missense probably damaging 0.97
R5512:Cars UTSW 7 143570133 missense possibly damaging 0.91
R6505:Cars UTSW 7 143565007 missense probably damaging 1.00
R7125:Cars UTSW 7 143584773 missense probably benign 0.01
R7641:Cars UTSW 7 143587103 critical splice donor site probably null
R7674:Cars UTSW 7 143587103 critical splice donor site probably null
R7812:Cars UTSW 7 143570047 missense probably damaging 1.00
X0021:Cars UTSW 7 143576584 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCAGGACAGGCTATGATG -3'
(R):5'- AGGGACTATGTCACGTTTCTG -3'

Sequencing Primer
(F):5'- CTATGATGGAGAGAGATCTTCAGCC -3'
(R):5'- GTCACGTTTCTGTCCCAAGGAATAAG -3'
Posted On2016-04-15