Incidental Mutation 'R4921:Adam3'
ID378587
Institutional Source Beutler Lab
Gene Symbol Adam3
Ensembl Gene ENSMUSG00000031553
Gene Namea disintegrin and metallopeptidase domain 3 (cyritestin)
SynonymsADAM3, Taz83, Taz83, Cyrn1, tMDC
MMRRC Submission 042523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24677225-24725852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24684614 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 712 (M712V)
Ref Sequence ENSEMBL: ENSMUSP00000132651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033958] [ENSMUST00000167431] [ENSMUST00000170318] [ENSMUST00000171438]
Predicted Effect probably benign
Transcript: ENSMUST00000033958
AA Change: M712V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000033958
Gene: ENSMUSG00000031553
AA Change: M712V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 144 3.8e-30 PFAM
Pfam:Reprolysin_5 185 361 6.8e-9 PFAM
Pfam:Reprolysin 187 384 1.6e-64 PFAM
Pfam:Reprolysin_3 211 333 1.2e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158677
Predicted Effect probably benign
Transcript: ENSMUST00000167431
SMART Domains Protein: ENSMUSP00000127479
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170318
SMART Domains Protein: ENSMUSP00000132620
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 118 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171438
AA Change: M712V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132651
Gene: ENSMUSG00000031553
AA Change: M712V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 23 144 2.4e-22 PFAM
Pfam:Reprolysin_5 185 361 7.8e-9 PFAM
Pfam:Reprolysin 187 384 4.1e-64 PFAM
Pfam:Reprolysin_3 211 321 1e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are male infertile, due to the inability of the sperm to bind to the zona pellucida. If the zona pellucida is removed sperm-egg membrane fusion happens as expected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Adam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Adam3 APN 8 24694278 missense probably damaging 1.00
IGL01792:Adam3 APN 8 24697203 missense probably benign 0.27
IGL01894:Adam3 APN 8 24687938 missense probably benign 0.33
IGL01941:Adam3 APN 8 24681446 utr 3 prime probably benign
IGL02355:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02362:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02511:Adam3 APN 8 24695176 missense probably damaging 0.98
IGL03070:Adam3 APN 8 24703784 missense probably damaging 1.00
IGL03106:Adam3 APN 8 24715119 splice site probably benign
IGL03238:Adam3 APN 8 24687965 unclassified probably null
I2288:Adam3 UTSW 8 24684661 missense probably damaging 1.00
R0511:Adam3 UTSW 8 24695315 missense probably damaging 1.00
R1103:Adam3 UTSW 8 24714271 splice site probably benign
R1104:Adam3 UTSW 8 24681529 missense probably benign 0.10
R1430:Adam3 UTSW 8 24714271 splice site probably benign
R1599:Adam3 UTSW 8 24725361 missense possibly damaging 0.50
R1663:Adam3 UTSW 8 24687933 missense probably benign 0.03
R2023:Adam3 UTSW 8 24689463 missense possibly damaging 0.93
R2278:Adam3 UTSW 8 24711384 missense probably damaging 0.99
R3033:Adam3 UTSW 8 24694211 missense probably benign 0.00
R3440:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3441:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3688:Adam3 UTSW 8 24703848 missense probably benign 0.02
R4478:Adam3 UTSW 8 24695155 missense probably benign 0.04
R4654:Adam3 UTSW 8 24703803 missense probably damaging 1.00
R4811:Adam3 UTSW 8 24711724 missense probably benign 0.10
R4910:Adam3 UTSW 8 24694305 missense probably benign 0.03
R4941:Adam3 UTSW 8 24677316 unclassified probably benign
R5239:Adam3 UTSW 8 24694191 missense possibly damaging 0.62
R5771:Adam3 UTSW 8 24707411 missense probably benign 0.00
R5897:Adam3 UTSW 8 24697228 missense probably benign 0.00
R5916:Adam3 UTSW 8 24684539 critical splice donor site probably null
R5979:Adam3 UTSW 8 24677367 missense probably benign 0.03
R6168:Adam3 UTSW 8 24681614 splice site probably null
R6189:Adam3 UTSW 8 24711336 missense probably benign 0.01
R6801:Adam3 UTSW 8 24684664 missense possibly damaging 0.61
R6997:Adam3 UTSW 8 24681523 missense probably benign 0.10
R7065:Adam3 UTSW 8 24711675 critical splice donor site probably null
R7074:Adam3 UTSW 8 24694347 missense probably benign 0.01
R7151:Adam3 UTSW 8 24695255 missense probably damaging 1.00
R7208:Adam3 UTSW 8 24711401 missense probably damaging 0.98
R7341:Adam3 UTSW 8 24687980 missense possibly damaging 0.60
R7528:Adam3 UTSW 8 24677263 missense unknown
R7797:Adam3 UTSW 8 24694644 missense probably damaging 1.00
R7891:Adam3 UTSW 8 24707497 critical splice acceptor site probably null
R7974:Adam3 UTSW 8 24707497 critical splice acceptor site probably null
R8064:Adam3 UTSW 8 24681550 missense probably benign 0.10
X0063:Adam3 UTSW 8 24711706 missense probably damaging 0.96
Z1088:Adam3 UTSW 8 24681431 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTTTGTCCAAGCAACCATC -3'
(R):5'- GAAACCGAGACGTCACTGTG -3'

Sequencing Primer
(F):5'- TTGTCCAAGCAACCATCCCTCC -3'
(R):5'- AACTAAGATCACTGCTCTGCTTCAG -3'
Posted On2016-04-15