Mutagenetix > Incidental Mutation

Incidental Mutation 'R4921:Rpgrip1l'

378594

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1l

Ensembl Gene

ENSMUSG00000033282

Gene Name

Rpgrip1-like

Synonyms

Nphp8, fantom, Ftm, 1700047E16Rik

MMRRC Submission

042523-MU

Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4921 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91217030-91313262 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91261009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 807 (S807G)

Ref Sequence

ENSEMBL: ENSMUSP00000042702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113] [ENSMUST00000209616]

AlphaFold

Q8CG73

Predicted Effect

probably benign
Transcript: ENSMUST00000047783
AA Change: S807G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: S807G

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC
coiled coil region	196	268	N/A	INTRINSIC
coiled coil region	299	371	N/A	INTRINSIC
coiled coil region	395	454	N/A	INTRINSIC
coiled coil region	520	556	N/A	INTRINSIC
Pfam:C2-C2_1	597	738	5.8e-61	PFAM
low complexity region	769	778	N/A	INTRINSIC
C2	791	896	1.06e-5	SMART
low complexity region	989	1000	N/A	INTRINSIC
low complexity region	1057	1080	N/A	INTRINSIC
Blast:C2	1098	1223	3e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000139113

SMART Domains

Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209616

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210054

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.3%

Validation Efficiency

MGI Phenotype

Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,796	N65K	probably benign	Het
Abcc9	T	C	6: 142,590,436	Y1524C	probably benign	Het
Acap1	A	G	11: 69,887,193	I102T	probably damaging	Het
Acvr2a	T	C	2: 48,893,541	V284A	possibly damaging	Het
Adam3	T	C	8: 24,684,614	M712V	probably benign	Het
Adck1	T	C	12: 88,441,138	V213A	probably benign	Het
Adgrl3	G	T	5: 81,512,110	W242L	probably damaging	Het
Alk	T	C	17: 71,904,315	T857A	probably benign	Het
Alms1	A	G	6: 85,628,546	T2393A	probably benign	Het
Ank3	C	T	10: 70,002,109	P240L	probably damaging	Het
Ankrd35	C	A	3: 96,684,824	L809M	possibly damaging	Het
Birc6	T	A	17: 74,650,099	L3690Q	probably damaging	Het
Bmp3	C	A	5: 98,872,061	F114L	probably damaging	Het
Cage1	G	A	13: 38,019,208	H627Y	probably benign	Het
Cars	T	C	7: 143,569,475	D468G	probably damaging	Het
Ccdc148	T	C	2: 58,829,802	E487G	probably damaging	Het
Ccdc80	A	T	16: 45,118,167	I746F	probably damaging	Het
Ccl25	A	G	8: 4,353,913	Q119R	possibly damaging	Het
Cdh24	C	T	14: 54,633,215	D178N	probably damaging	Het
Cdk12	A	T	11: 98,222,687	T766S	unknown	Het
Chst15	T	A	7: 132,247,884	T443S	probably benign	Het
Cnbp	T	C	6: 87,845,146	D125G	possibly damaging	Het
Cntn2	A	T	1: 132,516,032	V1003E	possibly damaging	Het
Crct1	A	G	3: 93,014,825		probably benign	Het
Dand5	C	T	8: 84,816,484	C121Y	probably damaging	Het
Dmkn	A	T	7: 30,771,233	D382V	probably damaging	Het
Dnase2b	T	A	3: 146,593,441	T86S	probably damaging	Het
Dusp8	GCCACCACCACCACCACCACCACC	GCCACCACCACCACCACCACC	7: 142,082,154		probably benign	Het
Eef1akmt1	C	T	14: 57,550,632	V90M	probably damaging	Het
Egfl7	G	T	2: 26,590,980	W168L	probably benign	Het
Ep400	A	G	5: 110,665,810	C2908R	probably damaging	Het
Espl1	A	G	15: 102,315,241	K1076E	probably damaging	Het
Exoc4	A	G	6: 33,910,517	N747D	probably benign	Het
Fancm	T	C	12: 65,077,141	V191A	probably benign	Het
Fbxo17	A	G	7: 28,732,789	D97G	probably benign	Het
Fer1l6	G	T	15: 58,600,311		probably null	Het
Flt4	T	C	11: 49,627,143	W337R	probably damaging	Het
Fpr-rs7	T	C	17: 20,113,820	H136R	possibly damaging	Het
Frem3	T	A	8: 80,613,136	I686N	possibly damaging	Het
Galnt9	A	G	5: 110,577,449	K84R	probably damaging	Het
Gfm2	T	A	13: 97,175,676	M760K	probably damaging	Het
Glis3	T	C	19: 28,666,104	T13A	probably damaging	Het
Gm13078	A	T	4: 143,728,326	K398M	possibly damaging	Het
H2-K1	A	G	17: 33,997,076	V323A	possibly damaging	Het
Hbb-bs	G	A	7: 103,826,720	A130V	probably damaging	Het
Herc2	T	A	7: 56,229,690	H4685Q	probably benign	Het
Ighv5-9-1	C	T	12: 113,736,294	R56H	possibly damaging	Het
Itgb4	A	G	11: 116,006,605	N1548S	probably benign	Het
Itpr3	T	C	17: 27,098,005	Y745H	probably damaging	Het
Kank3	G	T	17: 33,817,200	G14V	probably damaging	Het
Kif24	G	T	4: 41,394,329	S982Y	probably damaging	Het
Kifc5b	C	T	17: 26,921,023	R53W	probably damaging	Het
Krt39	A	G	11: 99,514,749	S442P	possibly damaging	Het
Lcat	G	A	8: 105,942,442	P67L	possibly damaging	Het
Maml2	T	C	9: 13,621,175	S562P	probably damaging	Het
Map3k8	G	A	18: 4,349,124	R65W	possibly damaging	Het
Mbd3	G	T	10: 80,395,576	R12S	probably damaging	Het
Msr1	T	C	8: 39,624,251	E106G	possibly damaging	Het
Myh4	T	A	11: 67,254,028	L1256Q	probably damaging	Het
Mypn	G	A	10: 63,147,936	T511M	possibly damaging	Het
Nub1	A	T	5: 24,701,469	N331I	probably benign	Het
Nup107	A	G	10: 117,770,511	V440A	possibly damaging	Het
Ofcc1	A	G	13: 40,214,517	F174L	probably benign	Het
Olfr1497	T	C	19: 13,795,465	I49V	probably benign	Het
Olfr597	A	T	7: 103,320,543	N44I	probably damaging	Het
Olfr975	A	C	9: 39,950,225	V182G	probably damaging	Het
Parp2	C	A	14: 50,819,268	L310I	probably damaging	Het
Pcdh20	A	G	14: 88,469,726	V46A	probably benign	Het
Pcdhgb6	A	G	18: 37,743,472	D411G	probably damaging	Het
Pkd1l2	T	C	8: 117,054,885	E807G	probably benign	Het
Pkd1l2	A	T	8: 117,072,549	N267K	probably damaging	Het
Rell1	C	A	5: 63,936,033	M126I	probably damaging	Het
Robo4	G	A	9: 37,402,560	E36K	probably benign	Het
Rpl10a	T	C	17: 28,330,852	V169A	probably benign	Het
Rubcn	C	T	16: 32,847,294	V166I	probably damaging	Het
Sall2	T	C	14: 52,315,393	E113G	possibly damaging	Het
Sars2	T	C	7: 28,752,438	S423P	possibly damaging	Het
Scaper	A	G	9: 55,892,235	I182T	probably benign	Het
Selp	A	G	1: 164,141,397	D522G	possibly damaging	Het
Sema4b	T	A	7: 80,198,756	I35N	possibly damaging	Het
Sgce	A	T	6: 4,694,153	F268I	probably damaging	Het
Slc14a2	G	T	18: 78,192,188	A258E	probably damaging	Het
Slc17a9	T	C	2: 180,735,949	Y213H	probably benign	Het
Slc22a7	T	G	17: 46,436,933	I233L	probably benign	Het
Slc35f1	A	G	10: 53,062,602	Q210R	probably damaging	Het
Slc6a21	A	G	7: 45,288,310	E350G	possibly damaging	Het
Spata21	A	T	4: 141,112,091	D639V	probably damaging	Het
Svil	A	G	18: 5,108,631	D1519G	probably damaging	Het
Tbccd1	T	C	16: 22,841,899	T56A	probably benign	Het
Tigit	A	T	16: 43,662,017	I118N	probably damaging	Het
Tlr11	A	T	14: 50,362,885	Q776L	possibly damaging	Het
Tspan12	A	C	6: 21,835,449	I9S	possibly damaging	Het
Unc5c	T	A	3: 141,788,966	Y347N	probably damaging	Het
Unk	A	G	11: 116,054,945	T481A	probably benign	Het
Vmn1r192	A	C	13: 22,187,480	V190G	probably damaging	Het
Vnn3	A	T	10: 23,864,575	M259L	probably benign	Het
Zan	T	C	5: 137,408,370		probably benign	Het
Zdhhc6	T	C	19: 55,313,210	H113R	probably damaging	Het

Other mutations in Rpgrip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rpgrip1l	APN	8	91263574	missense	possibly damaging	0.52
IGL00932:Rpgrip1l	APN	8	91275637	missense	probably benign	0.33
IGL01113:Rpgrip1l	APN	8	91260739	intron	probably benign
IGL01151:Rpgrip1l	APN	8	91275149	missense	probably damaging	1.00
IGL01321:Rpgrip1l	APN	8	91260873	nonsense	probably null
IGL01384:Rpgrip1l	APN	8	91273640	missense	probably benign	0.00
IGL01634:Rpgrip1l	APN	8	91252543	missense	probably benign
IGL01634:Rpgrip1l	APN	8	91252544	missense	probably benign	0.25
IGL01781:Rpgrip1l	APN	8	91270218	missense	probably benign	0.16
IGL01784:Rpgrip1l	APN	8	91270461	missense	possibly damaging	0.56
IGL02034:Rpgrip1l	APN	8	91251148	critical splice donor site	probably null
IGL02250:Rpgrip1l	APN	8	91232861	missense	probably benign	0.00
IGL02285:Rpgrip1l	APN	8	91232907	missense	possibly damaging	0.92
IGL02634:Rpgrip1l	APN	8	91225344	splice site	probably benign
IGL02736:Rpgrip1l	APN	8	91263591	missense	possibly damaging	0.91
IGL02825:Rpgrip1l	APN	8	91304805	missense	possibly damaging	0.67
IGL02962:Rpgrip1l	APN	8	91270362	missense	possibly damaging	0.95
IGL03031:Rpgrip1l	APN	8	91260783	missense	probably damaging	1.00
IGL03184:Rpgrip1l	APN	8	91300809	missense	probably damaging	1.00
P0005:Rpgrip1l	UTSW	8	91299225	splice site	probably benign
R0118:Rpgrip1l	UTSW	8	91270122	missense	probably damaging	1.00
R0490:Rpgrip1l	UTSW	8	91299845	splice site	probably benign
R0599:Rpgrip1l	UTSW	8	91305000	missense	probably damaging	1.00
R1514:Rpgrip1l	UTSW	8	91260750	missense	probably damaging	1.00
R1648:Rpgrip1l	UTSW	8	91252889	missense	probably damaging	1.00
R1914:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R1915:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R2093:Rpgrip1l	UTSW	8	91270132	missense	possibly damaging	0.87
R2225:Rpgrip1l	UTSW	8	91221467	missense	probably benign	0.45
R2504:Rpgrip1l	UTSW	8	91280716	critical splice donor site	probably null
R3859:Rpgrip1l	UTSW	8	91263658	missense	probably benign	0.00
R4118:Rpgrip1l	UTSW	8	91252907	missense	probably benign
R4801:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4802:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4976:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5092:Rpgrip1l	UTSW	8	91221384	nonsense	probably null
R5099:Rpgrip1l	UTSW	8	91248722	missense	probably benign	0.20
R5119:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5141:Rpgrip1l	UTSW	8	91260918	missense	probably benign	0.29
R5793:Rpgrip1l	UTSW	8	91260772	missense	probably benign	0.06
R5847:Rpgrip1l	UTSW	8	91304985	missense	probably damaging	1.00
R5871:Rpgrip1l	UTSW	8	91221386	missense	possibly damaging	0.89
R5916:Rpgrip1l	UTSW	8	91252913	missense	possibly damaging	0.93
R6619:Rpgrip1l	UTSW	8	91232871	missense	possibly damaging	0.69
R6654:Rpgrip1l	UTSW	8	91220205	missense	probably benign	0.36
R6956:Rpgrip1l	UTSW	8	91286313	splice site	probably null
R6984:Rpgrip1l	UTSW	8	91260798	missense	probably benign	0.03
R7064:Rpgrip1l	UTSW	8	91263520	nonsense	probably null
R7145:Rpgrip1l	UTSW	8	91232806	critical splice donor site	probably null
R7243:Rpgrip1l	UTSW	8	91270123	missense	probably benign	0.00
R7673:Rpgrip1l	UTSW	8	91300787	missense	possibly damaging	0.89
R7796:Rpgrip1l	UTSW	8	91270237	missense	probably damaging	1.00
R8684:Rpgrip1l	UTSW	8	91273701	missense	probably benign	0.00
R8769:Rpgrip1l	UTSW	8	91252584	splice site	probably benign
R8955:Rpgrip1l	UTSW	8	91280828	missense	possibly damaging	0.67
R9006:Rpgrip1l	UTSW	8	91280808	missense	probably benign
R9085:Rpgrip1l	UTSW	8	91287675	missense	possibly damaging	0.68
R9188:Rpgrip1l	UTSW	8	91305010	missense	probably damaging	1.00
R9258:Rpgrip1l	UTSW	8	91260986	nonsense	probably null
R9268:Rpgrip1l	UTSW	8	91280727	missense	probably benign
R9366:Rpgrip1l	UTSW	8	91270181	nonsense	probably null
R9547:Rpgrip1l	UTSW	8	91251245	missense	probably benign	0.00
R9565:Rpgrip1l	UTSW	8	91304888	missense	probably benign	0.05
R9582:Rpgrip1l	UTSW	8	91270258	missense	probably benign	0.03
R9604:Rpgrip1l	UTSW	8	91304805	missense	possibly damaging	0.67
R9614:Rpgrip1l	UTSW	8	91260806	missense	possibly damaging	0.79
R9697:Rpgrip1l	UTSW	8	91260763	missense	possibly damaging	0.49
Z1088:Rpgrip1l	UTSW	8	91220179	makesense	probably null
Z1088:Rpgrip1l	UTSW	8	91260975	missense	possibly damaging	0.96
Z1088:Rpgrip1l	UTSW	8	91270120	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGAGGCACATTGACTTTTCCC -3'
(R):5'- AGGTTGGAAGCTGATAGTTACC -3'

Sequencing Primer
(F):5'- TCCCATGTAAATATTCTCCTGGG -3'
(R):5'- TGGAAGCTGATAGTTACCTTTAATTG -3'

Posted On

2016-04-15