Incidental Mutation 'R4921:Lcat'
ID378595
Institutional Source Beutler Lab
Gene Symbol Lcat
Ensembl Gene ENSMUSG00000035237
Gene Namelecithin cholesterol acyltransferase
SynonymsD8Wsu61e
MMRRC Submission 042523-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105939551-105943382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105942442 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 67 (P67L)
Ref Sequence ENSEMBL: ENSMUSP00000038232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034369] [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]
Predicted Effect probably benign
Transcript: ENSMUST00000034369
SMART Domains Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897

DomainStartEndE-ValueType
Pfam:Proteasome 36 217 3.9e-49 PFAM
Pfam:Pr_beta_C 231 267 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034370
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000038896
AA Change: P67L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237
AA Change: P67L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116429
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212876
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes display severe hypoalphalipoproteinemia, variable hypertriglyceridemia, and accumulation of heterogeneous pre-beta HDL, as well as an attenuated increase in apoB-containing lipoproteins in response to dietary cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Lcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02494:Lcat APN 8 105941939 unclassified probably benign
IGL02654:Lcat APN 8 105939769 missense possibly damaging 0.68
IGL02678:Lcat APN 8 105941940 splice site probably null
IGL02963:Lcat APN 8 105939956 missense probably damaging 0.99
IGL03304:Lcat APN 8 105940063 missense possibly damaging 0.94
R1754:Lcat UTSW 8 105941814 frame shift probably null
R1757:Lcat UTSW 8 105941814 frame shift probably null
R1824:Lcat UTSW 8 105939888 missense probably damaging 0.98
R1962:Lcat UTSW 8 105941723 missense probably damaging 0.98
R2866:Lcat UTSW 8 105939879 missense probably damaging 0.98
R4091:Lcat UTSW 8 105939906 missense probably benign 0.09
R4172:Lcat UTSW 8 105942427 missense possibly damaging 0.56
R5487:Lcat UTSW 8 105939664 missense probably benign
R6552:Lcat UTSW 8 105939679 missense possibly damaging 0.58
R7096:Lcat UTSW 8 105939677 missense possibly damaging 0.76
R7789:Lcat UTSW 8 105942225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGACATTTAGCAGCCAGC -3'
(R):5'- CCCCTTGGACTTTGGCAATAATG -3'

Sequencing Primer
(F):5'- CAGCCAAGGGTCAACGTG -3'
(R):5'- AACCTTCCGTGCCTGAAG -3'
Posted On2016-04-15