Mutagenetix > Incidental Mutation

Incidental Mutation 'R4921:Robo4'

378601

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

1200012D01Rik, Magic roundabout

MMRRC Submission

042523-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R4921 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37401897-37415115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 37402560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 36 (E36K)

Ref Sequence

ENSEMBL: ENSMUSP00000150722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]

AlphaFold

Q8C310

Predicted Effect

probably benign
Transcript: ENSMUST00000102895
AA Change: E36K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: E36K

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115046
AA Change: E36K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: E36K

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115048

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972
AA Change: E36K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000214185
AA Change: E36K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,796	N65K	probably benign	Het
Abcc9	T	C	6: 142,590,436	Y1524C	probably benign	Het
Acap1	A	G	11: 69,887,193	I102T	probably damaging	Het
Acvr2a	T	C	2: 48,893,541	V284A	possibly damaging	Het
Adam3	T	C	8: 24,684,614	M712V	probably benign	Het
Adck1	T	C	12: 88,441,138	V213A	probably benign	Het
Adgrl3	G	T	5: 81,512,110	W242L	probably damaging	Het
Alk	T	C	17: 71,904,315	T857A	probably benign	Het
Alms1	A	G	6: 85,628,546	T2393A	probably benign	Het
Ank3	C	T	10: 70,002,109	P240L	probably damaging	Het
Ankrd35	C	A	3: 96,684,824	L809M	possibly damaging	Het
Birc6	T	A	17: 74,650,099	L3690Q	probably damaging	Het
Bmp3	C	A	5: 98,872,061	F114L	probably damaging	Het
Cage1	G	A	13: 38,019,208	H627Y	probably benign	Het
Cars	T	C	7: 143,569,475	D468G	probably damaging	Het
Ccdc148	T	C	2: 58,829,802	E487G	probably damaging	Het
Ccdc80	A	T	16: 45,118,167	I746F	probably damaging	Het
Ccl25	A	G	8: 4,353,913	Q119R	possibly damaging	Het
Cdh24	C	T	14: 54,633,215	D178N	probably damaging	Het
Cdk12	A	T	11: 98,222,687	T766S	unknown	Het
Chst15	T	A	7: 132,247,884	T443S	probably benign	Het
Cnbp	T	C	6: 87,845,146	D125G	possibly damaging	Het
Cntn2	A	T	1: 132,516,032	V1003E	possibly damaging	Het
Crct1	A	G	3: 93,014,825		probably benign	Het
Dand5	C	T	8: 84,816,484	C121Y	probably damaging	Het
Dmkn	A	T	7: 30,771,233	D382V	probably damaging	Het
Dnase2b	T	A	3: 146,593,441	T86S	probably damaging	Het
Dusp8	GCCACCACCACCACCACCACCACC	GCCACCACCACCACCACCACC	7: 142,082,154		probably benign	Het
Eef1akmt1	C	T	14: 57,550,632	V90M	probably damaging	Het
Egfl7	G	T	2: 26,590,980	W168L	probably benign	Het
Ep400	A	G	5: 110,665,810	C2908R	probably damaging	Het
Espl1	A	G	15: 102,315,241	K1076E	probably damaging	Het
Exoc4	A	G	6: 33,910,517	N747D	probably benign	Het
Fancm	T	C	12: 65,077,141	V191A	probably benign	Het
Fbxo17	A	G	7: 28,732,789	D97G	probably benign	Het
Fer1l6	G	T	15: 58,600,311		probably null	Het
Flt4	T	C	11: 49,627,143	W337R	probably damaging	Het
Fpr-rs7	T	C	17: 20,113,820	H136R	possibly damaging	Het
Frem3	T	A	8: 80,613,136	I686N	possibly damaging	Het
Galnt9	A	G	5: 110,577,449	K84R	probably damaging	Het
Gfm2	T	A	13: 97,175,676	M760K	probably damaging	Het
Glis3	T	C	19: 28,666,104	T13A	probably damaging	Het
Gm13078	A	T	4: 143,728,326	K398M	possibly damaging	Het
H2-K1	A	G	17: 33,997,076	V323A	possibly damaging	Het
Hbb-bs	G	A	7: 103,826,720	A130V	probably damaging	Het
Herc2	T	A	7: 56,229,690	H4685Q	probably benign	Het
Ighv5-9-1	C	T	12: 113,736,294	R56H	possibly damaging	Het
Itgb4	A	G	11: 116,006,605	N1548S	probably benign	Het
Itpr3	T	C	17: 27,098,005	Y745H	probably damaging	Het
Kank3	G	T	17: 33,817,200	G14V	probably damaging	Het
Kif24	G	T	4: 41,394,329	S982Y	probably damaging	Het
Kifc5b	C	T	17: 26,921,023	R53W	probably damaging	Het
Krt39	A	G	11: 99,514,749	S442P	possibly damaging	Het
Lcat	G	A	8: 105,942,442	P67L	possibly damaging	Het
Maml2	T	C	9: 13,621,175	S562P	probably damaging	Het
Map3k8	G	A	18: 4,349,124	R65W	possibly damaging	Het
Mbd3	G	T	10: 80,395,576	R12S	probably damaging	Het
Msr1	T	C	8: 39,624,251	E106G	possibly damaging	Het
Myh4	T	A	11: 67,254,028	L1256Q	probably damaging	Het
Mypn	G	A	10: 63,147,936	T511M	possibly damaging	Het
Nub1	A	T	5: 24,701,469	N331I	probably benign	Het
Nup107	A	G	10: 117,770,511	V440A	possibly damaging	Het
Ofcc1	A	G	13: 40,214,517	F174L	probably benign	Het
Olfr1497	T	C	19: 13,795,465	I49V	probably benign	Het
Olfr597	A	T	7: 103,320,543	N44I	probably damaging	Het
Olfr975	A	C	9: 39,950,225	V182G	probably damaging	Het
Parp2	C	A	14: 50,819,268	L310I	probably damaging	Het
Pcdh20	A	G	14: 88,469,726	V46A	probably benign	Het
Pcdhgb6	A	G	18: 37,743,472	D411G	probably damaging	Het
Pkd1l2	T	C	8: 117,054,885	E807G	probably benign	Het
Pkd1l2	A	T	8: 117,072,549	N267K	probably damaging	Het
Rell1	C	A	5: 63,936,033	M126I	probably damaging	Het
Rpgrip1l	T	C	8: 91,261,009	S807G	probably benign	Het
Rpl10a	T	C	17: 28,330,852	V169A	probably benign	Het
Rubcn	C	T	16: 32,847,294	V166I	probably damaging	Het
Sall2	T	C	14: 52,315,393	E113G	possibly damaging	Het
Sars2	T	C	7: 28,752,438	S423P	possibly damaging	Het
Scaper	A	G	9: 55,892,235	I182T	probably benign	Het
Selp	A	G	1: 164,141,397	D522G	possibly damaging	Het
Sema4b	T	A	7: 80,198,756	I35N	possibly damaging	Het
Sgce	A	T	6: 4,694,153	F268I	probably damaging	Het
Slc14a2	G	T	18: 78,192,188	A258E	probably damaging	Het
Slc17a9	T	C	2: 180,735,949	Y213H	probably benign	Het
Slc22a7	T	G	17: 46,436,933	I233L	probably benign	Het
Slc35f1	A	G	10: 53,062,602	Q210R	probably damaging	Het
Slc6a21	A	G	7: 45,288,310	E350G	possibly damaging	Het
Spata21	A	T	4: 141,112,091	D639V	probably damaging	Het
Svil	A	G	18: 5,108,631	D1519G	probably damaging	Het
Tbccd1	T	C	16: 22,841,899	T56A	probably benign	Het
Tigit	A	T	16: 43,662,017	I118N	probably damaging	Het
Tlr11	A	T	14: 50,362,885	Q776L	possibly damaging	Het
Tspan12	A	C	6: 21,835,449	I9S	possibly damaging	Het
Unc5c	T	A	3: 141,788,966	Y347N	probably damaging	Het
Unk	A	G	11: 116,054,945	T481A	probably benign	Het
Vmn1r192	A	C	13: 22,187,480	V190G	probably damaging	Het
Vnn3	A	T	10: 23,864,575	M259L	probably benign	Het
Zan	T	C	5: 137,408,370		probably benign	Het
Zdhhc6	T	C	19: 55,313,210	H113R	probably damaging	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37411104	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37408229	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37405935	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37408211	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37406000	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37413040	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37408200	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37408374	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37413382	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37408176	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37410469	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37404284	splice site	probably benign
IGL03102:Robo4	APN	9	37404185	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37405810	intron	probably benign
PIT4305001:Robo4	UTSW	9	37411391	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37404766	splice site	probably benign
R1005:Robo4	UTSW	9	37408251	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37413052	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37408052	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37410840	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37408076	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37403227	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37403443	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37413059	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37404070	splice site	probably benign
R2203:Robo4	UTSW	9	37411490	frame shift	probably null
R2204:Robo4	UTSW	9	37411490	frame shift	probably null
R2351:Robo4	UTSW	9	37411660	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37402662	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37404476	nonsense	probably null
R2851:Robo4	UTSW	9	37411490	frame shift	probably null
R2852:Robo4	UTSW	9	37411490	frame shift	probably null
R2877:Robo4	UTSW	9	37411490	frame shift	probably null
R3123:Robo4	UTSW	9	37411490	frame shift	probably null
R3124:Robo4	UTSW	9	37411490	frame shift	probably null
R3125:Robo4	UTSW	9	37411490	frame shift	probably null
R3805:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37411490	frame shift	probably null
R3905:Robo4	UTSW	9	37403505	nonsense	probably null
R3938:Robo4	UTSW	9	37402017	start gained	probably benign
R4261:Robo4	UTSW	9	37405581	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37411490	frame shift	probably null
R4435:Robo4	UTSW	9	37411490	frame shift	probably null
R4561:Robo4	UTSW	9	37411490	frame shift	probably null
R4562:Robo4	UTSW	9	37411490	frame shift	probably null
R4568:Robo4	UTSW	9	37404822	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37403199	missense	probably damaging	1.00
R5000:Robo4	UTSW	9	37408368	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37404806	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37411490	frame shift	probably null
R5279:Robo4	UTSW	9	37411490	frame shift	probably null
R5285:Robo4	UTSW	9	37411490	frame shift	probably null
R5347:Robo4	UTSW	9	37411490	frame shift	probably null
R5348:Robo4	UTSW	9	37411490	frame shift	probably null
R5361:Robo4	UTSW	9	37413378	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37411490	frame shift	probably null
R5404:Robo4	UTSW	9	37411490	frame shift	probably null
R5488:Robo4	UTSW	9	37411490	frame shift	probably null
R5489:Robo4	UTSW	9	37411490	frame shift	probably null
R5490:Robo4	UTSW	9	37411490	frame shift	probably null
R5494:Robo4	UTSW	9	37411490	frame shift	probably null
R5629:Robo4	UTSW	9	37408362	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37404797	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37411674	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37411400	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37405630	nonsense	probably null
R6189:Robo4	UTSW	9	37403533	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37410712	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37404368	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37402067	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37402705	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37410981	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37402809	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37405574	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37413122	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37410759	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37402635	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37405640	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37404076	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37403505	nonsense	probably null
R8547:Robo4	UTSW	9	37404378	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37408281	missense	possibly damaging	0.92
R8836:Robo4	UTSW	9	37405834	missense	unknown
R8889:Robo4	UTSW	9	37403305	missense	probably benign	0.00
R9018:Robo4	UTSW	9	37404224	missense	probably benign	0.00
R9182:Robo4	UTSW	9	37401910	start gained	probably benign
R9375:Robo4	UTSW	9	37404862	missense	probably damaging	1.00
R9621:Robo4	UTSW	9	37406213	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGAGCATCTCTGTTGTCTGG -3'
(R):5'- CCGGCAAAAGGTAATGTAGGTC -3'

Sequencing Primer
(F):5'- CCTTTCTTCTAGTTAGCAGTGAAG -3'
(R):5'- CAAAAGGTAATGTAGGTCTGGGGTG -3'

Posted On

2016-04-15