Incidental Mutation 'R4921:Rubcn'
ID 378637
Institutional Source Beutler Lab
Gene Symbol Rubcn
Ensembl Gene ENSMUSG00000035629
Gene Name RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms 1700021K19Rik
MMRRC Submission 042523-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.888) question?
Stock # R4921 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 32642072-32698121 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32667664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 166 (V166I)
Ref Sequence ENSEMBL: ENSMUSP00000155943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040986] [ENSMUST00000089684] [ENSMUST00000115105] [ENSMUST00000119810] [ENSMUST00000231478] [ENSMUST00000232269]
AlphaFold Q80U62
Predicted Effect probably damaging
Transcript: ENSMUST00000040986
AA Change: V166I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048811
Gene: ENSMUSG00000035629
AA Change: V166I

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 469 687 1e-66 BLAST
DUF4206 706 908 1.66e-113 SMART
low complexity region 915 941 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089684
AA Change: V166I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087114
Gene: ENSMUSG00000035629
AA Change: V166I

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 484 702 1e-66 BLAST
DUF4206 721 923 1.66e-113 SMART
low complexity region 930 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115105
AA Change: V166I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629
AA Change: V166I

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119810
AA Change: V105I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629
AA Change: V105I

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231478
AA Change: V166I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000232269
AA Change: V166I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,885,662 (GRCm39) N65K probably benign Het
Abcc9 T C 6: 142,536,162 (GRCm39) Y1524C probably benign Het
Acap1 A G 11: 69,778,019 (GRCm39) I102T probably damaging Het
Acvr2a T C 2: 48,783,553 (GRCm39) V284A possibly damaging Het
Adam3 T C 8: 25,174,630 (GRCm39) M712V probably benign Het
Adck1 T C 12: 88,407,908 (GRCm39) V213A probably benign Het
Adgrl3 G T 5: 81,659,957 (GRCm39) W242L probably damaging Het
Alk T C 17: 72,211,310 (GRCm39) T857A probably benign Het
Alms1 A G 6: 85,605,528 (GRCm39) T2393A probably benign Het
Ank3 C T 10: 69,837,939 (GRCm39) P240L probably damaging Het
Ankrd35 C A 3: 96,592,140 (GRCm39) L809M possibly damaging Het
Birc6 T A 17: 74,957,094 (GRCm39) L3690Q probably damaging Het
Bmp3 C A 5: 99,019,920 (GRCm39) F114L probably damaging Het
Cage1 G A 13: 38,203,184 (GRCm39) H627Y probably benign Het
Cars1 T C 7: 143,123,212 (GRCm39) D468G probably damaging Het
Ccdc148 T C 2: 58,719,814 (GRCm39) E487G probably damaging Het
Ccdc80 A T 16: 44,938,530 (GRCm39) I746F probably damaging Het
Ccl25 A G 8: 4,403,913 (GRCm39) Q119R possibly damaging Het
Cdh24 C T 14: 54,870,672 (GRCm39) D178N probably damaging Het
Cdk12 A T 11: 98,113,513 (GRCm39) T766S unknown Het
Chst15 T A 7: 131,849,613 (GRCm39) T443S probably benign Het
Cnbp T C 6: 87,822,128 (GRCm39) D125G possibly damaging Het
Cntn2 A T 1: 132,443,770 (GRCm39) V1003E possibly damaging Het
Crct1 A G 3: 92,922,132 (GRCm39) probably benign Het
Dand5 C T 8: 85,543,113 (GRCm39) C121Y probably damaging Het
Dmkn A T 7: 30,470,658 (GRCm39) D382V probably damaging Het
Dnase2b T A 3: 146,299,196 (GRCm39) T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 141,635,891 (GRCm39) probably benign Het
Eef1akmt1 C T 14: 57,788,089 (GRCm39) V90M probably damaging Het
Egfl7 G T 2: 26,480,992 (GRCm39) W168L probably benign Het
Ep400 A G 5: 110,813,676 (GRCm39) C2908R probably damaging Het
Espl1 A G 15: 102,223,676 (GRCm39) K1076E probably damaging Het
Exoc4 A G 6: 33,887,452 (GRCm39) N747D probably benign Het
Fancm T C 12: 65,123,915 (GRCm39) V191A probably benign Het
Fbxo17 A G 7: 28,432,214 (GRCm39) D97G probably benign Het
Fer1l6 G T 15: 58,472,160 (GRCm39) probably null Het
Flt4 T C 11: 49,517,970 (GRCm39) W337R probably damaging Het
Fpr-rs7 T C 17: 20,334,082 (GRCm39) H136R possibly damaging Het
Frem3 T A 8: 81,339,765 (GRCm39) I686N possibly damaging Het
Galnt9 A G 5: 110,725,315 (GRCm39) K84R probably damaging Het
Gfm2 T A 13: 97,312,184 (GRCm39) M760K probably damaging Het
Glis3 T C 19: 28,643,504 (GRCm39) T13A probably damaging Het
H2-K2 A G 17: 34,216,050 (GRCm39) V323A possibly damaging Het
Hbb-bs G A 7: 103,475,927 (GRCm39) A130V probably damaging Het
Herc2 T A 7: 55,879,438 (GRCm39) H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,699,914 (GRCm39) R56H possibly damaging Het
Itgb4 A G 11: 115,897,431 (GRCm39) N1548S probably benign Het
Itpr3 T C 17: 27,316,979 (GRCm39) Y745H probably damaging Het
Kank3 G T 17: 34,036,174 (GRCm39) G14V probably damaging Het
Kif24 G T 4: 41,394,329 (GRCm39) S982Y probably damaging Het
Kifc5b C T 17: 27,139,997 (GRCm39) R53W probably damaging Het
Krt39 A G 11: 99,405,575 (GRCm39) S442P possibly damaging Het
Lcat G A 8: 106,669,074 (GRCm39) P67L possibly damaging Het
Maml2 T C 9: 13,532,471 (GRCm39) S562P probably damaging Het
Map3k8 G A 18: 4,349,124 (GRCm39) R65W possibly damaging Het
Mbd3 G T 10: 80,231,410 (GRCm39) R12S probably damaging Het
Msr1 T C 8: 40,077,292 (GRCm39) E106G possibly damaging Het
Myh4 T A 11: 67,144,854 (GRCm39) L1256Q probably damaging Het
Mypn G A 10: 62,983,715 (GRCm39) T511M possibly damaging Het
Nub1 A T 5: 24,906,467 (GRCm39) N331I probably benign Het
Nup107 A G 10: 117,606,416 (GRCm39) V440A possibly damaging Het
Ofcc1 A G 13: 40,367,993 (GRCm39) F174L probably benign Het
Or10d5 A C 9: 39,861,521 (GRCm39) V182G probably damaging Het
Or52ab2 A T 7: 102,969,750 (GRCm39) N44I probably damaging Het
Or9q2 T C 19: 13,772,829 (GRCm39) I49V probably benign Het
Parp2 C A 14: 51,056,725 (GRCm39) L310I probably damaging Het
Pcdh20 A G 14: 88,707,162 (GRCm39) V46A probably benign Het
Pcdhgb6 A G 18: 37,876,525 (GRCm39) D411G probably damaging Het
Pkd1l2 T C 8: 117,781,624 (GRCm39) E807G probably benign Het
Pkd1l2 A T 8: 117,799,288 (GRCm39) N267K probably damaging Het
Pramel24 A T 4: 143,454,896 (GRCm39) K398M possibly damaging Het
Rell1 C A 5: 64,093,376 (GRCm39) M126I probably damaging Het
Robo4 G A 9: 37,313,856 (GRCm39) E36K probably benign Het
Rpgrip1l T C 8: 91,987,637 (GRCm39) S807G probably benign Het
Rpl10a T C 17: 28,549,826 (GRCm39) V169A probably benign Het
Sall2 T C 14: 52,552,850 (GRCm39) E113G possibly damaging Het
Sars2 T C 7: 28,451,863 (GRCm39) S423P possibly damaging Het
Scaper A G 9: 55,799,519 (GRCm39) I182T probably benign Het
Selp A G 1: 163,968,966 (GRCm39) D522G possibly damaging Het
Sema4b T A 7: 79,848,504 (GRCm39) I35N possibly damaging Het
Sgce A T 6: 4,694,153 (GRCm39) F268I probably damaging Het
Slc14a2 G T 18: 78,235,403 (GRCm39) A258E probably damaging Het
Slc17a9 T C 2: 180,377,742 (GRCm39) Y213H probably benign Het
Slc22a7 T G 17: 46,747,859 (GRCm39) I233L probably benign Het
Slc35f1 A G 10: 52,938,698 (GRCm39) Q210R probably damaging Het
Slc6a21 A G 7: 44,937,734 (GRCm39) E350G possibly damaging Het
Spata21 A T 4: 140,839,402 (GRCm39) D639V probably damaging Het
Svil A G 18: 5,108,631 (GRCm39) D1519G probably damaging Het
Tbccd1 T C 16: 22,660,649 (GRCm39) T56A probably benign Het
Tigit A T 16: 43,482,380 (GRCm39) I118N probably damaging Het
Tlr11 A T 14: 50,600,342 (GRCm39) Q776L possibly damaging Het
Tspan12 A C 6: 21,835,448 (GRCm39) I9S possibly damaging Het
Unc5c T A 3: 141,494,727 (GRCm39) Y347N probably damaging Het
Unk A G 11: 115,945,771 (GRCm39) T481A probably benign Het
Vmn1r192 A C 13: 22,371,650 (GRCm39) V190G probably damaging Het
Vnn3 A T 10: 23,740,473 (GRCm39) M259L probably benign Het
Zan T C 5: 137,406,632 (GRCm39) probably benign Het
Zdhhc6 T C 19: 55,301,642 (GRCm39) H113R probably damaging Het
Other mutations in Rubcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rubcn APN 16 32,644,747 (GRCm39) critical splice donor site probably null
IGL00777:Rubcn APN 16 32,656,933 (GRCm39) missense probably damaging 0.98
IGL01402:Rubcn APN 16 32,647,666 (GRCm39) missense probably damaging 1.00
IGL01404:Rubcn APN 16 32,647,666 (GRCm39) missense probably damaging 1.00
IGL02255:Rubcn APN 16 32,647,715 (GRCm39) missense probably benign 0.04
IGL03019:Rubcn APN 16 32,647,077 (GRCm39) missense probably damaging 0.98
IGL03388:Rubcn APN 16 32,661,938 (GRCm39) missense probably benign 0.02
R0254:Rubcn UTSW 16 32,668,316 (GRCm39) missense probably benign 0.00
R0373:Rubcn UTSW 16 32,656,350 (GRCm39) missense probably damaging 1.00
R0636:Rubcn UTSW 16 32,649,056 (GRCm39) missense probably damaging 1.00
R0839:Rubcn UTSW 16 32,647,713 (GRCm39) missense probably damaging 0.98
R0967:Rubcn UTSW 16 32,646,087 (GRCm39) missense probably benign 0.00
R1711:Rubcn UTSW 16 32,663,471 (GRCm39) missense probably damaging 1.00
R1819:Rubcn UTSW 16 32,647,284 (GRCm39) missense possibly damaging 0.93
R1840:Rubcn UTSW 16 32,646,542 (GRCm39) missense possibly damaging 0.83
R2511:Rubcn UTSW 16 32,667,624 (GRCm39) missense probably damaging 1.00
R3932:Rubcn UTSW 16 32,649,629 (GRCm39) splice site probably null
R3933:Rubcn UTSW 16 32,649,629 (GRCm39) splice site probably null
R4384:Rubcn UTSW 16 32,677,272 (GRCm39) missense probably damaging 0.96
R4788:Rubcn UTSW 16 32,656,778 (GRCm39) critical splice donor site probably null
R4852:Rubcn UTSW 16 32,663,678 (GRCm39) missense probably damaging 1.00
R4950:Rubcn UTSW 16 32,663,563 (GRCm39) missense probably damaging 1.00
R5234:Rubcn UTSW 16 32,656,828 (GRCm39) missense probably damaging 1.00
R5527:Rubcn UTSW 16 32,647,081 (GRCm39) missense probably damaging 1.00
R5616:Rubcn UTSW 16 32,647,293 (GRCm39) missense possibly damaging 0.76
R5823:Rubcn UTSW 16 32,670,091 (GRCm39) missense probably damaging 0.98
R6970:Rubcn UTSW 16 32,688,514 (GRCm39) intron probably benign
R7120:Rubcn UTSW 16 32,656,839 (GRCm39) missense probably damaging 1.00
R7121:Rubcn UTSW 16 32,656,839 (GRCm39) missense probably damaging 1.00
R7221:Rubcn UTSW 16 32,687,293 (GRCm39) splice site probably null
R7833:Rubcn UTSW 16 32,688,644 (GRCm39) start gained probably benign
R8108:Rubcn UTSW 16 32,677,320 (GRCm39) missense probably damaging 1.00
R8211:Rubcn UTSW 16 32,656,913 (GRCm39) missense possibly damaging 0.87
R8923:Rubcn UTSW 16 32,646,049 (GRCm39) missense probably damaging 1.00
R9046:Rubcn UTSW 16 32,661,940 (GRCm39) missense probably benign 0.00
R9587:Rubcn UTSW 16 32,663,679 (GRCm39) missense probably damaging 1.00
R9694:Rubcn UTSW 16 32,663,481 (GRCm39) missense probably benign 0.22
X0065:Rubcn UTSW 16 32,668,355 (GRCm39) missense possibly damaging 0.85
Z1176:Rubcn UTSW 16 32,663,533 (GRCm39) missense probably benign 0.00
Z1177:Rubcn UTSW 16 32,645,959 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTAAGTCTGTCAGCGCACAG -3'
(R):5'- CCAATTCTGGGCCTTTCTGG -3'

Sequencing Primer
(F):5'- CACAGCTGCCTCAGTGAG -3'
(R):5'- TTACGTTAGACTGCACACGG -3'
Posted On 2016-04-15