Incidental Mutation 'R4921:Itpr3'
ID378642
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Nameinositol 1,4,5-triphosphate receptor 3
Synonymstf, Ip3r3, Itpr-3
MMRRC Submission 042523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27057304-27122223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27098005 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 745 (Y745H)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049308
AA Change: Y745H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: Y745H

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143605
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTACCTGCTTCCTGTAAGG -3'
(R):5'- CACTCTTTAATGGTGATGGCCG -3'

Sequencing Primer
(F):5'- GACCTGTCCCAGCCCAG -3'
(R):5'- CGTGGGGATCTCTGTCCAG -3'
Posted On2016-04-15