Mutagenetix > Incidental Mutation

Incidental Mutation 'R4921:Itpr3'

378642

Institutional Source

Beutler Lab

Gene Symbol

Itpr3

Ensembl Gene

ENSMUSG00000042644

Gene Name

inositol 1,4,5-triphosphate receptor 3

Synonyms

tf, Ip3r3, Itpr-3

MMRRC Submission

042523-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4921 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27057304-27122223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27098005 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 745 (Y745H)

Ref Sequence

ENSEMBL: ENSMUSP00000038150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049308]

AlphaFold

P70227

PDB Structure

Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049308
AA Change: Y745H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: Y745H

Domain	Start	End	E-Value	Type
MIR	113	167	7.75e-6	SMART
MIR	174	224	1.16e-4	SMART
MIR	232	288	1.21e-7	SMART
MIR	295	402	9.38e-14	SMART
Pfam:RYDR_ITPR	473	670	7.8e-64	PFAM
low complexity region	881	889	N/A	INTRINSIC
Pfam:RYDR_ITPR	1175	1333	5.8e-16	PFAM
low complexity region	1549	1567	N/A	INTRINSIC
low complexity region	1831	1851	N/A	INTRINSIC
Pfam:RIH_assoc	1863	1973	2.6e-34	PFAM
transmembrane domain	2203	2225	N/A	INTRINSIC
Pfam:Ion_trans	2235	2527	8.1e-20	PFAM
coiled coil region	2631	2660	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143605

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,796	N65K	probably benign	Het
Abcc9	T	C	6: 142,590,436	Y1524C	probably benign	Het
Acap1	A	G	11: 69,887,193	I102T	probably damaging	Het
Acvr2a	T	C	2: 48,893,541	V284A	possibly damaging	Het
Adam3	T	C	8: 24,684,614	M712V	probably benign	Het
Adck1	T	C	12: 88,441,138	V213A	probably benign	Het
Adgrl3	G	T	5: 81,512,110	W242L	probably damaging	Het
Alk	T	C	17: 71,904,315	T857A	probably benign	Het
Alms1	A	G	6: 85,628,546	T2393A	probably benign	Het
Ank3	C	T	10: 70,002,109	P240L	probably damaging	Het
Ankrd35	C	A	3: 96,684,824	L809M	possibly damaging	Het
Birc6	T	A	17: 74,650,099	L3690Q	probably damaging	Het
Bmp3	C	A	5: 98,872,061	F114L	probably damaging	Het
Cage1	G	A	13: 38,019,208	H627Y	probably benign	Het
Cars	T	C	7: 143,569,475	D468G	probably damaging	Het
Ccdc148	T	C	2: 58,829,802	E487G	probably damaging	Het
Ccdc80	A	T	16: 45,118,167	I746F	probably damaging	Het
Ccl25	A	G	8: 4,353,913	Q119R	possibly damaging	Het
Cdh24	C	T	14: 54,633,215	D178N	probably damaging	Het
Cdk12	A	T	11: 98,222,687	T766S	unknown	Het
Chst15	T	A	7: 132,247,884	T443S	probably benign	Het
Cnbp	T	C	6: 87,845,146	D125G	possibly damaging	Het
Cntn2	A	T	1: 132,516,032	V1003E	possibly damaging	Het
Crct1	A	G	3: 93,014,825		probably benign	Het
Dand5	C	T	8: 84,816,484	C121Y	probably damaging	Het
Dmkn	A	T	7: 30,771,233	D382V	probably damaging	Het
Dnase2b	T	A	3: 146,593,441	T86S	probably damaging	Het
Dusp8	GCCACCACCACCACCACCACCACC	GCCACCACCACCACCACCACC	7: 142,082,154		probably benign	Het
Eef1akmt1	C	T	14: 57,550,632	V90M	probably damaging	Het
Egfl7	G	T	2: 26,590,980	W168L	probably benign	Het
Ep400	A	G	5: 110,665,810	C2908R	probably damaging	Het
Espl1	A	G	15: 102,315,241	K1076E	probably damaging	Het
Exoc4	A	G	6: 33,910,517	N747D	probably benign	Het
Fancm	T	C	12: 65,077,141	V191A	probably benign	Het
Fbxo17	A	G	7: 28,732,789	D97G	probably benign	Het
Fer1l6	G	T	15: 58,600,311		probably null	Het
Flt4	T	C	11: 49,627,143	W337R	probably damaging	Het
Fpr-rs7	T	C	17: 20,113,820	H136R	possibly damaging	Het
Frem3	T	A	8: 80,613,136	I686N	possibly damaging	Het
Galnt9	A	G	5: 110,577,449	K84R	probably damaging	Het
Gfm2	T	A	13: 97,175,676	M760K	probably damaging	Het
Glis3	T	C	19: 28,666,104	T13A	probably damaging	Het
Gm13078	A	T	4: 143,728,326	K398M	possibly damaging	Het
H2-K1	A	G	17: 33,997,076	V323A	possibly damaging	Het
Hbb-bs	G	A	7: 103,826,720	A130V	probably damaging	Het
Herc2	T	A	7: 56,229,690	H4685Q	probably benign	Het
Ighv5-9-1	C	T	12: 113,736,294	R56H	possibly damaging	Het
Itgb4	A	G	11: 116,006,605	N1548S	probably benign	Het
Kank3	G	T	17: 33,817,200	G14V	probably damaging	Het
Kif24	G	T	4: 41,394,329	S982Y	probably damaging	Het
Kifc5b	C	T	17: 26,921,023	R53W	probably damaging	Het
Krt39	A	G	11: 99,514,749	S442P	possibly damaging	Het
Lcat	G	A	8: 105,942,442	P67L	possibly damaging	Het
Maml2	T	C	9: 13,621,175	S562P	probably damaging	Het
Map3k8	G	A	18: 4,349,124	R65W	possibly damaging	Het
Mbd3	G	T	10: 80,395,576	R12S	probably damaging	Het
Msr1	T	C	8: 39,624,251	E106G	possibly damaging	Het
Myh4	T	A	11: 67,254,028	L1256Q	probably damaging	Het
Mypn	G	A	10: 63,147,936	T511M	possibly damaging	Het
Nub1	A	T	5: 24,701,469	N331I	probably benign	Het
Nup107	A	G	10: 117,770,511	V440A	possibly damaging	Het
Ofcc1	A	G	13: 40,214,517	F174L	probably benign	Het
Olfr1497	T	C	19: 13,795,465	I49V	probably benign	Het
Olfr597	A	T	7: 103,320,543	N44I	probably damaging	Het
Olfr975	A	C	9: 39,950,225	V182G	probably damaging	Het
Parp2	C	A	14: 50,819,268	L310I	probably damaging	Het
Pcdh20	A	G	14: 88,469,726	V46A	probably benign	Het
Pcdhgb6	A	G	18: 37,743,472	D411G	probably damaging	Het
Pkd1l2	T	C	8: 117,054,885	E807G	probably benign	Het
Pkd1l2	A	T	8: 117,072,549	N267K	probably damaging	Het
Rell1	C	A	5: 63,936,033	M126I	probably damaging	Het
Robo4	G	A	9: 37,402,560	E36K	probably benign	Het
Rpgrip1l	T	C	8: 91,261,009	S807G	probably benign	Het
Rpl10a	T	C	17: 28,330,852	V169A	probably benign	Het
Rubcn	C	T	16: 32,847,294	V166I	probably damaging	Het
Sall2	T	C	14: 52,315,393	E113G	possibly damaging	Het
Sars2	T	C	7: 28,752,438	S423P	possibly damaging	Het
Scaper	A	G	9: 55,892,235	I182T	probably benign	Het
Selp	A	G	1: 164,141,397	D522G	possibly damaging	Het
Sema4b	T	A	7: 80,198,756	I35N	possibly damaging	Het
Sgce	A	T	6: 4,694,153	F268I	probably damaging	Het
Slc14a2	G	T	18: 78,192,188	A258E	probably damaging	Het
Slc17a9	T	C	2: 180,735,949	Y213H	probably benign	Het
Slc22a7	T	G	17: 46,436,933	I233L	probably benign	Het
Slc35f1	A	G	10: 53,062,602	Q210R	probably damaging	Het
Slc6a21	A	G	7: 45,288,310	E350G	possibly damaging	Het
Spata21	A	T	4: 141,112,091	D639V	probably damaging	Het
Svil	A	G	18: 5,108,631	D1519G	probably damaging	Het
Tbccd1	T	C	16: 22,841,899	T56A	probably benign	Het
Tigit	A	T	16: 43,662,017	I118N	probably damaging	Het
Tlr11	A	T	14: 50,362,885	Q776L	possibly damaging	Het
Tspan12	A	C	6: 21,835,449	I9S	possibly damaging	Het
Unc5c	T	A	3: 141,788,966	Y347N	probably damaging	Het
Unk	A	G	11: 116,054,945	T481A	probably benign	Het
Vmn1r192	A	C	13: 22,187,480	V190G	probably damaging	Het
Vnn3	A	T	10: 23,864,575	M259L	probably benign	Het
Zan	T	C	5: 137,408,370		probably benign	Het
Zdhhc6	T	C	19: 55,313,210	H113R	probably damaging	Het

Other mutations in Itpr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Itpr3	APN	17	27083629	missense	probably benign	0.05
IGL00980:Itpr3	APN	17	27110956	missense	probably benign
IGL01151:Itpr3	APN	17	27091529	missense	probably damaging	1.00
IGL01289:Itpr3	APN	17	27099765	missense	probably damaging	0.99
IGL01403:Itpr3	APN	17	27118595	missense	probably damaging	0.97
IGL01666:Itpr3	APN	17	27117178	missense	probably benign	0.02
IGL01897:Itpr3	APN	17	27111262	missense	probably damaging	1.00
IGL02003:Itpr3	APN	17	27121475	missense	probably damaging	1.00
IGL02012:Itpr3	APN	17	27104095	missense	probably benign
IGL02063:Itpr3	APN	17	27120023	missense	probably benign	0.01
IGL02146:Itpr3	APN	17	27117275	missense	probably damaging	1.00
IGL02158:Itpr3	APN	17	27098442	missense	probably damaging	1.00
IGL02177:Itpr3	APN	17	27099614	missense	possibly damaging	0.74
IGL02247:Itpr3	APN	17	27098179	missense	probably damaging	1.00
IGL02606:Itpr3	APN	17	27114512	splice site	probably benign
IGL02651:Itpr3	APN	17	27106398	missense	probably damaging	0.99
IGL02902:Itpr3	APN	17	27104556	missense	probably benign	0.21
IGL03001:Itpr3	APN	17	27089612	splice site	probably benign
IGL03004:Itpr3	APN	17	27097978	missense	possibly damaging	0.90
IGL03065:Itpr3	APN	17	27091933	missense	probably damaging	1.00
IGL03117:Itpr3	APN	17	27119266	missense	probably damaging	1.00
IGL03181:Itpr3	APN	17	27111268	missense	probably benign
IGL03404:Itpr3	APN	17	27091518	missense	probably damaging	1.00
Allure	UTSW	17	27107303	missense	probably damaging	1.00
alopecia	UTSW	17	27095478	missense	probably damaging	0.98
Beauty	UTSW	17	27106342	missense	probably damaging	1.00
Opuesto	UTSW	17	27087592	missense	probably damaging	1.00
Paradox	UTSW	17	27098171	missense	probably damaging	1.00
Pulchritude	UTSW	17	27086960	missense	probably damaging	0.97
R0010:Itpr3	UTSW	17	27120977	missense	probably damaging	1.00
R0055:Itpr3	UTSW	17	27098322	missense	probably damaging	1.00
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0104:Itpr3	UTSW	17	27095992	missense	probably benign	0.01
R0195:Itpr3	UTSW	17	27114114	missense	probably damaging	1.00
R0212:Itpr3	UTSW	17	27089319	missense	probably damaging	1.00
R0454:Itpr3	UTSW	17	27113819	missense	probably benign
R0485:Itpr3	UTSW	17	27111929	missense	probably damaging	0.98
R0501:Itpr3	UTSW	17	27107289	missense	probably benign	0.09
R0781:Itpr3	UTSW	17	27110555	missense	probably benign	0.00
R0890:Itpr3	UTSW	17	27089011	nonsense	probably null
R1028:Itpr3	UTSW	17	27091369	missense	probably benign	0.04
R1144:Itpr3	UTSW	17	27114923	missense	probably benign	0.01
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1458:Itpr3	UTSW	17	27118372	missense	probably benign	0.01
R1463:Itpr3	UTSW	17	27117154	splice site	probably benign
R1472:Itpr3	UTSW	17	27114225	missense	probably benign	0.09
R1529:Itpr3	UTSW	17	27105485	splice site	probably null
R1533:Itpr3	UTSW	17	27095560	missense	possibly damaging	0.71
R1537:Itpr3	UTSW	17	27114147	missense	possibly damaging	0.96
R1618:Itpr3	UTSW	17	27116607	critical splice acceptor site	probably null
R1672:Itpr3	UTSW	17	27089013	missense	probably benign
R1726:Itpr3	UTSW	17	27111690	missense	probably damaging	0.96
R1865:Itpr3	UTSW	17	27120023	missense	probably benign	0.01
R1940:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R2023:Itpr3	UTSW	17	27102811	missense	possibly damaging	0.76
R2063:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2064:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2065:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2067:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2068:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2219:Itpr3	UTSW	17	27115053	missense	probably benign
R2248:Itpr3	UTSW	17	27115059	missense	probably damaging	1.00
R2291:Itpr3	UTSW	17	27113579	missense	possibly damaging	0.92
R2320:Itpr3	UTSW	17	27095915	missense	probably benign
R2864:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R2865:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R3778:Itpr3	UTSW	17	27095472	missense	possibly damaging	0.57
R3881:Itpr3	UTSW	17	27113840	missense	probably benign	0.01
R3979:Itpr3	UTSW	17	27085131	missense	probably benign	0.23
R3979:Itpr3	UTSW	17	27091572	missense	probably damaging	1.00
R4224:Itpr3	UTSW	17	27107258	missense	probably damaging	1.00
R4259:Itpr3	UTSW	17	27106324	missense	probably damaging	1.00
R4321:Itpr3	UTSW	17	27111974	missense	probably benign	0.00
R4466:Itpr3	UTSW	17	27106342	missense	probably damaging	1.00
R4493:Itpr3	UTSW	17	27104612	missense	probably damaging	1.00
R4597:Itpr3	UTSW	17	27093283	missense	probably damaging	1.00
R4823:Itpr3	UTSW	17	27085147	missense	probably benign	0.30
R4974:Itpr3	UTSW	17	27083608	missense	probably damaging	0.96
R5063:Itpr3	UTSW	17	27089911	missense	possibly damaging	0.94
R5079:Itpr3	UTSW	17	27098423	missense	probably damaging	1.00
R5303:Itpr3	UTSW	17	27116689	missense	probably benign	0.38
R5518:Itpr3	UTSW	17	27087592	missense	probably damaging	1.00
R5521:Itpr3	UTSW	17	27107334	missense	probably benign	0.09
R5566:Itpr3	UTSW	17	27115952	missense	possibly damaging	0.71
R5567:Itpr3	UTSW	17	27103906	missense	possibly damaging	0.66
R5579:Itpr3	UTSW	17	27113519	missense	probably damaging	1.00
R5610:Itpr3	UTSW	17	27118566	missense	probably benign	0.42
R5658:Itpr3	UTSW	17	27107878	missense	possibly damaging	0.74
R5856:Itpr3	UTSW	17	27106405	missense	probably damaging	1.00
R5872:Itpr3	UTSW	17	27086976	missense	probably benign	0.02
R5878:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R5889:Itpr3	UTSW	17	27115065	missense	probably damaging	0.99
R5907:Itpr3	UTSW	17	27117893	missense	probably damaging	1.00
R5930:Itpr3	UTSW	17	27110921	missense	possibly damaging	0.49
R5987:Itpr3	UTSW	17	27104601	missense	probably damaging	1.00
R6029:Itpr3	UTSW	17	27098171	missense	probably damaging	1.00
R6195:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6213:Itpr3	UTSW	17	27111200	missense	probably benign	0.03
R6233:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6376:Itpr3	UTSW	17	27095475	missense	possibly damaging	0.94
R6514:Itpr3	UTSW	17	27091370	missense	probably benign
R6515:Itpr3	UTSW	17	27091370	missense	probably benign
R6516:Itpr3	UTSW	17	27091370	missense	probably benign
R6955:Itpr3	UTSW	17	27121467	missense	probably damaging	1.00
R7002:Itpr3	UTSW	17	27110580	missense	probably benign	0.00
R7064:Itpr3	UTSW	17	27089295	missense	probably damaging	1.00
R7257:Itpr3	UTSW	17	27118561	missense	probably benign	0.00
R7349:Itpr3	UTSW	17	27107812	splice site	probably null
R7469:Itpr3	UTSW	17	27121054	missense	possibly damaging	0.74
R7493:Itpr3	UTSW	17	27094800	missense	probably benign	0.09
R7510:Itpr3	UTSW	17	27089039	missense	probably damaging	0.97
R7565:Itpr3	UTSW	17	27110888	missense	probably benign	0.01
R7616:Itpr3	UTSW	17	27088977	missense	probably damaging	1.00
R7728:Itpr3	UTSW	17	27098114	missense	probably damaging	1.00
R7779:Itpr3	UTSW	17	27096063	missense	probably damaging	1.00
R7788:Itpr3	UTSW	17	27118597	nonsense	probably null
R7871:Itpr3	UTSW	17	27117179	missense	probably damaging	1.00
R7889:Itpr3	UTSW	17	27116777	missense	probably damaging	1.00
R7966:Itpr3	UTSW	17	27112028	critical splice donor site	probably null
R8065:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8067:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8230:Itpr3	UTSW	17	27107737	critical splice donor site	probably null
R8263:Itpr3	UTSW	17	27115913	nonsense	probably null
R8264:Itpr3	UTSW	17	27104112	synonymous	silent
R8269:Itpr3	UTSW	17	27093284	missense	possibly damaging	0.60
R8271:Itpr3	UTSW	17	27087648	missense	probably damaging	1.00
R8316:Itpr3	UTSW	17	27106225	missense	possibly damaging	0.50
R8354:Itpr3	UTSW	17	27115919	missense	possibly damaging	0.74
R8413:Itpr3	UTSW	17	27111926	missense	probably damaging	1.00
R8437:Itpr3	UTSW	17	27107303	missense	probably damaging	1.00
R8676:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8679:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8846:Itpr3	UTSW	17	27112022	missense	probably damaging	1.00
R8884:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8885:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8886:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8887:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8888:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8891:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8896:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8975:Itpr3	UTSW	17	27116654	missense	possibly damaging	0.56
R9025:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9026:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9063:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9087:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9088:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9089:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9090:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9091:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9200:Itpr3	UTSW	17	27107662	missense	probably damaging	0.99
R9270:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9271:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9294:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R9389:Itpr3	UTSW	17	27095925	missense	possibly damaging	0.84
R9433:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9434:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9443:Itpr3	UTSW	17	27105549	missense	probably damaging	1.00
R9472:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9474:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9475:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9476:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9477:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9507:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9508:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9511:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9694:Itpr3	UTSW	17	27115953	missense	probably damaging	0.99
R9789:Itpr3	UTSW	17	27089941	missense	probably benign	0.15
V7732:Itpr3	UTSW	17	27111024	splice site	probably benign
V7732:Itpr3	UTSW	17	27111026	splice site	probably null
Z1088:Itpr3	UTSW	17	27113528	missense	possibly damaging	0.50
Z1177:Itpr3	UTSW	17	27114929	missense	probably damaging	1.00
Z1177:Itpr3	UTSW	17	27119987	missense	probably damaging	1.00
Z31818:Itpr3	UTSW	17	27095478	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCTACCTGCTTCCTGTAAGG -3'
(R):5'- CACTCTTTAATGGTGATGGCCG -3'

Sequencing Primer
(F):5'- GACCTGTCCCAGCCCAG -3'
(R):5'- CGTGGGGATCTCTGTCCAG -3'

Posted On

2016-04-15