Mutagenetix > Incidental Mutation

Incidental Mutation 'R4921:Svil'

378651

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

042523-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R4921 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5108631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1519 (D1519G)

Ref Sequence

ENSEMBL: ENSMUSP00000119287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]

AlphaFold

Q8K4L3

Predicted Effect

probably damaging
Transcript: ENSMUST00000025079
AA Change: D1923G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: D1923G

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125512

SMART Domains

Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	168	178	N/A	INTRINSIC
GEL	384	483	4.58e-22	SMART
GEL	508	625	4.03e-1	SMART
Blast:GEL	695	733	1e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000126977
AA Change: D1923G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: D1923G

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127297
AA Change: D1809G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: D1809G

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131609
AA Change: D1923G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: D1923G

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140448
AA Change: D1923G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: D1923G

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143254
AA Change: D1519G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: D1519G

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146723

SMART Domains

Protein: ENSMUSP00000115591
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
Blast:GEL	2	37	1e-17	BLAST
SCOP:d1d0na6	53	168	3e-19	SMART
Blast:GEL	63	169	1e-72	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000210707
AA Change: D2010G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,796	N65K	probably benign	Het
Abcc9	T	C	6: 142,590,436	Y1524C	probably benign	Het
Acap1	A	G	11: 69,887,193	I102T	probably damaging	Het
Acvr2a	T	C	2: 48,893,541	V284A	possibly damaging	Het
Adam3	T	C	8: 24,684,614	M712V	probably benign	Het
Adck1	T	C	12: 88,441,138	V213A	probably benign	Het
Adgrl3	G	T	5: 81,512,110	W242L	probably damaging	Het
Alk	T	C	17: 71,904,315	T857A	probably benign	Het
Alms1	A	G	6: 85,628,546	T2393A	probably benign	Het
Ank3	C	T	10: 70,002,109	P240L	probably damaging	Het
Ankrd35	C	A	3: 96,684,824	L809M	possibly damaging	Het
Birc6	T	A	17: 74,650,099	L3690Q	probably damaging	Het
Bmp3	C	A	5: 98,872,061	F114L	probably damaging	Het
Cage1	G	A	13: 38,019,208	H627Y	probably benign	Het
Cars	T	C	7: 143,569,475	D468G	probably damaging	Het
Ccdc148	T	C	2: 58,829,802	E487G	probably damaging	Het
Ccdc80	A	T	16: 45,118,167	I746F	probably damaging	Het
Ccl25	A	G	8: 4,353,913	Q119R	possibly damaging	Het
Cdh24	C	T	14: 54,633,215	D178N	probably damaging	Het
Cdk12	A	T	11: 98,222,687	T766S	unknown	Het
Chst15	T	A	7: 132,247,884	T443S	probably benign	Het
Cnbp	T	C	6: 87,845,146	D125G	possibly damaging	Het
Cntn2	A	T	1: 132,516,032	V1003E	possibly damaging	Het
Crct1	A	G	3: 93,014,825		probably benign	Het
Dand5	C	T	8: 84,816,484	C121Y	probably damaging	Het
Dmkn	A	T	7: 30,771,233	D382V	probably damaging	Het
Dnase2b	T	A	3: 146,593,441	T86S	probably damaging	Het
Dusp8	GCCACCACCACCACCACCACCACC	GCCACCACCACCACCACCACC	7: 142,082,154		probably benign	Het
Eef1akmt1	C	T	14: 57,550,632	V90M	probably damaging	Het
Egfl7	G	T	2: 26,590,980	W168L	probably benign	Het
Ep400	A	G	5: 110,665,810	C2908R	probably damaging	Het
Espl1	A	G	15: 102,315,241	K1076E	probably damaging	Het
Exoc4	A	G	6: 33,910,517	N747D	probably benign	Het
Fancm	T	C	12: 65,077,141	V191A	probably benign	Het
Fbxo17	A	G	7: 28,732,789	D97G	probably benign	Het
Fer1l6	G	T	15: 58,600,311		probably null	Het
Flt4	T	C	11: 49,627,143	W337R	probably damaging	Het
Fpr-rs7	T	C	17: 20,113,820	H136R	possibly damaging	Het
Frem3	T	A	8: 80,613,136	I686N	possibly damaging	Het
Galnt9	A	G	5: 110,577,449	K84R	probably damaging	Het
Gfm2	T	A	13: 97,175,676	M760K	probably damaging	Het
Glis3	T	C	19: 28,666,104	T13A	probably damaging	Het
Gm13078	A	T	4: 143,728,326	K398M	possibly damaging	Het
H2-K1	A	G	17: 33,997,076	V323A	possibly damaging	Het
Hbb-bs	G	A	7: 103,826,720	A130V	probably damaging	Het
Herc2	T	A	7: 56,229,690	H4685Q	probably benign	Het
Ighv5-9-1	C	T	12: 113,736,294	R56H	possibly damaging	Het
Itgb4	A	G	11: 116,006,605	N1548S	probably benign	Het
Itpr3	T	C	17: 27,098,005	Y745H	probably damaging	Het
Kank3	G	T	17: 33,817,200	G14V	probably damaging	Het
Kif24	G	T	4: 41,394,329	S982Y	probably damaging	Het
Kifc5b	C	T	17: 26,921,023	R53W	probably damaging	Het
Krt39	A	G	11: 99,514,749	S442P	possibly damaging	Het
Lcat	G	A	8: 105,942,442	P67L	possibly damaging	Het
Maml2	T	C	9: 13,621,175	S562P	probably damaging	Het
Map3k8	G	A	18: 4,349,124	R65W	possibly damaging	Het
Mbd3	G	T	10: 80,395,576	R12S	probably damaging	Het
Msr1	T	C	8: 39,624,251	E106G	possibly damaging	Het
Myh4	T	A	11: 67,254,028	L1256Q	probably damaging	Het
Mypn	G	A	10: 63,147,936	T511M	possibly damaging	Het
Nub1	A	T	5: 24,701,469	N331I	probably benign	Het
Nup107	A	G	10: 117,770,511	V440A	possibly damaging	Het
Ofcc1	A	G	13: 40,214,517	F174L	probably benign	Het
Olfr1497	T	C	19: 13,795,465	I49V	probably benign	Het
Olfr597	A	T	7: 103,320,543	N44I	probably damaging	Het
Olfr975	A	C	9: 39,950,225	V182G	probably damaging	Het
Parp2	C	A	14: 50,819,268	L310I	probably damaging	Het
Pcdh20	A	G	14: 88,469,726	V46A	probably benign	Het
Pcdhgb6	A	G	18: 37,743,472	D411G	probably damaging	Het
Pkd1l2	T	C	8: 117,054,885	E807G	probably benign	Het
Pkd1l2	A	T	8: 117,072,549	N267K	probably damaging	Het
Rell1	C	A	5: 63,936,033	M126I	probably damaging	Het
Robo4	G	A	9: 37,402,560	E36K	probably benign	Het
Rpgrip1l	T	C	8: 91,261,009	S807G	probably benign	Het
Rpl10a	T	C	17: 28,330,852	V169A	probably benign	Het
Rubcn	C	T	16: 32,847,294	V166I	probably damaging	Het
Sall2	T	C	14: 52,315,393	E113G	possibly damaging	Het
Sars2	T	C	7: 28,752,438	S423P	possibly damaging	Het
Scaper	A	G	9: 55,892,235	I182T	probably benign	Het
Selp	A	G	1: 164,141,397	D522G	possibly damaging	Het
Sema4b	T	A	7: 80,198,756	I35N	possibly damaging	Het
Sgce	A	T	6: 4,694,153	F268I	probably damaging	Het
Slc14a2	G	T	18: 78,192,188	A258E	probably damaging	Het
Slc17a9	T	C	2: 180,735,949	Y213H	probably benign	Het
Slc22a7	T	G	17: 46,436,933	I233L	probably benign	Het
Slc35f1	A	G	10: 53,062,602	Q210R	probably damaging	Het
Slc6a21	A	G	7: 45,288,310	E350G	possibly damaging	Het
Spata21	A	T	4: 141,112,091	D639V	probably damaging	Het
Tbccd1	T	C	16: 22,841,899	T56A	probably benign	Het
Tigit	A	T	16: 43,662,017	I118N	probably damaging	Het
Tlr11	A	T	14: 50,362,885	Q776L	possibly damaging	Het
Tspan12	A	C	6: 21,835,449	I9S	possibly damaging	Het
Unc5c	T	A	3: 141,788,966	Y347N	probably damaging	Het
Unk	A	G	11: 116,054,945	T481A	probably benign	Het
Vmn1r192	A	C	13: 22,187,480	V190G	probably damaging	Het
Vnn3	A	T	10: 23,864,575	M259L	probably benign	Het
Zan	T	C	5: 137,408,370		probably benign	Het
Zdhhc6	T	C	19: 55,313,210	H113R	probably damaging	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
R3779_Svil_985	UTSW	18	5090855	missense	probably damaging	0.97
R5433_Svil_176	UTSW	18	5059294	missense	probably damaging	0.99
R6062_Svil_873	UTSW	18	5106724	missense	probably damaging	1.00
BB002:Svil	UTSW	18	5118357	missense	probably benign	0.00
BB012:Svil	UTSW	18	5118357	missense	probably benign	0.00
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0281:Svil	UTSW	18	5094582	missense	probably damaging	1.00
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0617:Svil	UTSW	18	5117002	missense	probably damaging	1.00
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R1945:Svil	UTSW	18	5117059	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5061:Svil	UTSW	18	5048954	missense	probably benign	0.02
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	splice site	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6114:Svil	UTSW	18	5108639	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R6916:Svil	UTSW	18	5114682	utr 3 prime	probably benign
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
R7925:Svil	UTSW	18	5118357	missense	probably benign	0.00
R8113:Svil	UTSW	18	5062385	missense	probably damaging	1.00
R8263:Svil	UTSW	18	5108679	missense	probably damaging	1.00
R8485:Svil	UTSW	18	5064566	missense	probably benign	0.03
R8491:Svil	UTSW	18	5106678	missense	probably damaging	1.00
R8752:Svil	UTSW	18	5060366	intron	probably benign
R8774:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8774-TAIL:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8780:Svil	UTSW	18	5063449	missense	probably benign	0.00
R8787:Svil	UTSW	18	5059332	nonsense	probably null
R8790:Svil	UTSW	18	5056098	missense	possibly damaging	0.82
R8974:Svil	UTSW	18	5099650	missense	probably damaging	1.00
R9029:Svil	UTSW	18	5056239	missense	probably benign
R9072:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9073:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9079:Svil	UTSW	18	5056308	missense	probably benign	0.31
R9181:Svil	UTSW	18	5090833	missense	possibly damaging	0.75
R9363:Svil	UTSW	18	5037155	missense	probably benign	0.02
R9377:Svil	UTSW	18	5057294	missense	probably benign	0.06
R9381:Svil	UTSW	18	5099013	missense	probably benign	0.06
R9389:Svil	UTSW	18	5090811	missense	possibly damaging	0.52
R9566:Svil	UTSW	18	5099661	missense	probably damaging	1.00
R9607:Svil	UTSW	18	5058126	missense	possibly damaging	0.92
R9716:Svil	UTSW	18	5062370	missense	probably damaging	1.00
R9801:Svil	UTSW	18	5049062	missense	probably damaging	1.00
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00
Z1177:Svil	UTSW	18	5062344	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTCCCTGGAGCATACTGG -3'
(R):5'- GGGAATCATGCCCAAACCTC -3'

Sequencing Primer
(F):5'- CAAATGCTGGGGGAACTTTTAC -3'
(R):5'- GCCCAAACCTCAATAAATGTCTTGTG -3'

Posted On

2016-04-15