Incidental Mutation 'R4922:Fancm'
ID378708
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission 042524-MU
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R4922 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 65106892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000221838] [ENSMUST00000222540]
Predicted Effect probably null
Transcript: ENSMUST00000058889
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000221838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222521
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (76/78)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 13,986,819 H10R possibly damaging Het
4932438A13Rik T A 3: 36,987,165 I2564K probably damaging Het
5830473C10Rik A G 5: 90,579,711 H396R possibly damaging Het
Adgrb2 G T 4: 130,007,852 C423F probably damaging Het
Akap11 A T 14: 78,512,780 Y722* probably null Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Arfgef3 T A 10: 18,592,186 R1755S probably damaging Het
Atf7ip A T 6: 136,560,041 T91S possibly damaging Het
B020004J07Rik T A 4: 101,835,532 M424L probably benign Het
Bcl2 C A 1: 106,712,646 A79S probably benign Het
Bmp10 C T 6: 87,433,575 P117S probably benign Het
Bmpr2 A G 1: 59,867,424 T559A probably benign Het
Cd200r1 A T 16: 44,789,676 Y86F probably damaging Het
Cemip T A 7: 83,947,100 probably benign Het
Cfap52 A G 11: 67,931,722 probably null Het
Chml T C 1: 175,687,146 H60R possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Clec12a A G 6: 129,359,478 Y201C probably damaging Het
Col15a1 T C 4: 47,258,719 V370A probably benign Het
Cpsf3 T C 12: 21,301,537 I353T probably damaging Het
Csf2rb T A 15: 78,346,467 V470E probably benign Het
Cyp4a10 C A 4: 115,521,094 Q126K probably benign Het
Dennd1b T C 1: 139,085,914 S249P probably damaging Het
Dnase2a A G 8: 84,908,996 probably null Het
Dpp10 T C 1: 123,378,153 N490S probably benign Het
Enc1 C T 13: 97,245,735 A251V probably benign Het
Fancd2 T C 6: 113,585,473 V1258A probably benign Het
Fbxo16 C T 14: 65,299,208 T177I probably benign Het
Gm10471 A T 5: 26,084,793 I212N probably damaging Het
Gm1965 T C 6: 89,146,543 noncoding transcript Het
Gm6768 A G 12: 119,262,517 noncoding transcript Het
Hal A T 10: 93,503,539 M497L probably damaging Het
Hectd4 T C 5: 121,359,315 L3936S possibly damaging Het
Hs3st4 G T 7: 124,397,187 G359W probably damaging Het
Il6st C T 13: 112,502,865 P608L probably damaging Het
Kctd18 A C 1: 57,965,548 probably benign Het
Kntc1 T A 5: 123,802,246 S1636T probably damaging Het
Lrrn1 A T 6: 107,568,350 S370C probably damaging Het
Mtcl1 A C 17: 66,348,479 C968G probably benign Het
Mylip G A 13: 45,408,762 A347T probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neu4 T A 1: 94,022,478 V53E probably damaging Het
Nxpe3 T C 16: 55,860,324 I302V probably benign Het
Olfr1229 A T 2: 89,282,467 L243Q possibly damaging Het
Olfr266 A T 3: 106,822,260 C100S probably damaging Het
Otos T C 1: 92,644,368 T79A probably damaging Het
Pde4a T C 9: 21,210,713 I578T probably damaging Het
Prex2 C T 1: 11,169,940 P927S probably damaging Het
Prrxl1 A T 14: 32,608,406 N160I probably damaging Het
Prune2 A T 19: 17,122,752 K1873N probably benign Het
Ptk7 C A 17: 46,576,491 probably null Het
Reln T A 5: 21,995,587 probably null Het
Rgl2 A G 17: 33,932,775 probably benign Het
Rnf145 T A 11: 44,557,236 probably benign Het
Ryr2 T C 13: 11,709,963 E2488G probably damaging Het
Sgo2b A T 8: 63,926,630 M1056K possibly damaging Het
Snapc4 A G 2: 26,369,233 V635A probably benign Het
Snx19 T A 9: 30,437,467 Y101N probably benign Het
Sorl1 C A 9: 42,014,450 probably null Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tmem30b G A 12: 73,545,714 P209L probably damaging Het
Trbv12-2 G T 6: 41,119,147 C52F probably damaging Het
Tsc2 T A 17: 24,600,369 D1304V probably benign Het
Ugt2b36 T C 5: 87,066,324 Y487C probably damaging Het
Vmn1r10 T A 6: 57,113,826 N134K probably damaging Het
Wdr27 C A 17: 14,920,754 probably null Het
Wdr66 T C 5: 123,256,053 V335A probably benign Het
Wdr75 T C 1: 45,816,478 F430L probably damaging Het
Zfp629 A G 7: 127,612,127 I170T probably damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
R7498:Fancm UTSW 12 65099391 missense probably benign 0.01
R7585:Fancm UTSW 12 65106247 missense possibly damaging 0.62
R7610:Fancm UTSW 12 65105680 missense probably damaging 1.00
R7722:Fancm UTSW 12 65106461 missense probably damaging 1.00
R7740:Fancm UTSW 12 65126547 missense possibly damaging 0.90
R7867:Fancm UTSW 12 65116466 critical splice donor site probably null
R7867:Fancm UTSW 12 65118399 missense probably benign 0.12
R7882:Fancm UTSW 12 65126794 missense probably benign 0.12
R7950:Fancm UTSW 12 65116466 critical splice donor site probably null
R7950:Fancm UTSW 12 65118399 missense probably benign 0.12
R7965:Fancm UTSW 12 65126794 missense probably benign 0.12
Z1176:Fancm UTSW 12 65094926 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTAAGTCACACGCGAGCTC -3'
(R):5'- GGCCAAATCTCACACTTCTTTG -3'

Sequencing Primer
(F):5'- ACGCGAGCTCCAAGACAGG -3'
(R):5'- AGCATAAAACATTCCTATGGCATAC -3'
Posted On2016-04-15