Mutagenetix > Incidental Mutation

Incidental Mutation 'R4922:Ryr2'

378711

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

042524-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4922 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11567988-12121831 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11724849 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2488 (E2488G)

Ref Sequence

ENSEMBL: ENSMUSP00000021750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

PDB Structure

X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<

Predicted Effect

probably damaging
Transcript: ENSMUST00000021750
AA Change: E2488G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: E2488G

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170156
AA Change: E2488G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: E2488G

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Meta Mutation Damage Score

0.2262

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb2	G	T	4: 129,901,645 (GRCm39)	C423F	probably damaging	Het
Akap11	A	T	14: 78,750,220 (GRCm39)	Y722*	probably null	Het
Albfm1	A	G	5: 90,727,570 (GRCm39)	H396R	possibly damaging	Het
Anxa3	A	T	5: 96,968,288 (GRCm39)	I114F	probably damaging	Het
Arfgef3	T	A	10: 18,467,934 (GRCm39)	R1755S	probably damaging	Het
Atf7ip	A	T	6: 136,537,039 (GRCm39)	T91S	possibly damaging	Het
Bcl2	C	A	1: 106,640,376 (GRCm39)	A79S	probably benign	Het
Bltp1	T	A	3: 37,041,314 (GRCm39)	I2564K	probably damaging	Het
Bmerb1	A	G	16: 13,804,683 (GRCm39)	H10R	possibly damaging	Het
Bmp10	C	T	6: 87,410,557 (GRCm39)	P117S	probably benign	Het
Bmpr2	A	G	1: 59,906,583 (GRCm39)	T559A	probably benign	Het
Cd200r1	A	T	16: 44,610,039 (GRCm39)	Y86F	probably damaging	Het
Cemip	T	A	7: 83,596,308 (GRCm39)		probably benign	Het
Cfap251	T	C	5: 123,394,116 (GRCm39)	V335A	probably benign	Het
Cfap52	A	G	11: 67,822,548 (GRCm39)		probably null	Het
Chml	T	C	1: 175,514,712 (GRCm39)	H60R	possibly damaging	Het
Cic	TCCCCC	TCCCCCCCC	7: 24,991,095 (GRCm39)		probably benign	Het
Clec12a	A	G	6: 129,336,441 (GRCm39)	Y201C	probably damaging	Het
Col15a1	T	C	4: 47,258,719 (GRCm39)	V370A	probably benign	Het
Cpsf3	T	C	12: 21,351,538 (GRCm39)	I353T	probably damaging	Het
Csf2rb	T	A	15: 78,230,667 (GRCm39)	V470E	probably benign	Het
Cyp4a10	C	A	4: 115,378,291 (GRCm39)	Q126K	probably benign	Het
Dennd1b	T	C	1: 139,013,652 (GRCm39)	S249P	probably damaging	Het
Dnase2a	A	G	8: 85,635,625 (GRCm39)		probably null	Het
Dpp10	T	C	1: 123,305,882 (GRCm39)	N490S	probably benign	Het
Drgx	A	T	14: 32,330,363 (GRCm39)	N160I	probably damaging	Het
Enc1	C	T	13: 97,382,243 (GRCm39)	A251V	probably benign	Het
Fancd2	T	C	6: 113,562,434 (GRCm39)	V1258A	probably benign	Het
Fancm	G	A	12: 65,153,666 (GRCm39)		probably null	Het
Fbxo16	C	T	14: 65,536,657 (GRCm39)	T177I	probably benign	Het
Gm1965	T	C	6: 89,123,525 (GRCm39)		noncoding transcript	Het
Hal	A	T	10: 93,339,401 (GRCm39)	M497L	probably damaging	Het
Hectd4	T	C	5: 121,497,378 (GRCm39)	L3936S	possibly damaging	Het
Hs3st4	G	T	7: 123,996,410 (GRCm39)	G359W	probably damaging	Het
Il6st	C	T	13: 112,639,399 (GRCm39)	P608L	probably damaging	Het
Kctd18	A	C	1: 58,004,707 (GRCm39)		probably benign	Het
Kntc1	T	A	5: 123,940,309 (GRCm39)	S1636T	probably damaging	Het
Lrrn1	A	T	6: 107,545,311 (GRCm39)	S370C	probably damaging	Het
Mtcl1	A	C	17: 66,655,474 (GRCm39)	C968G	probably benign	Het
Mylip	G	A	13: 45,562,238 (GRCm39)	A347T	probably damaging	Het
Naip2	T	C	13: 100,291,468 (GRCm39)	S1157G	probably benign	Het
Ncoa4-ps	A	G	12: 119,226,252 (GRCm39)		noncoding transcript	Het
Neu4	T	A	1: 93,950,200 (GRCm39)	V53E	probably damaging	Het
Nxpe3	T	C	16: 55,680,687 (GRCm39)	I302V	probably benign	Het
Or11i1	A	T	3: 106,729,576 (GRCm39)	C100S	probably damaging	Het
Or4c15b	A	T	2: 89,112,811 (GRCm39)	L243Q	possibly damaging	Het
Otos	T	C	1: 92,572,090 (GRCm39)	T79A	probably damaging	Het
Pde4a	T	C	9: 21,122,009 (GRCm39)	I578T	probably damaging	Het
Pramel17	T	A	4: 101,692,729 (GRCm39)	M424L	probably benign	Het
Prex2	C	T	1: 11,240,164 (GRCm39)	P927S	probably damaging	Het
Prune2	A	T	19: 17,100,116 (GRCm39)	K1873N	probably benign	Het
Ptk7	C	A	17: 46,887,417 (GRCm39)		probably null	Het
Reln	T	A	5: 22,200,585 (GRCm39)		probably null	Het
Rgl2	A	G	17: 34,151,749 (GRCm39)		probably benign	Het
Rnf145	T	A	11: 44,448,063 (GRCm39)		probably benign	Het
Sgo2b	A	T	8: 64,379,664 (GRCm39)	M1056K	possibly damaging	Het
Snapc4	A	G	2: 26,259,245 (GRCm39)	V635A	probably benign	Het
Snx19	T	A	9: 30,348,763 (GRCm39)	Y101N	probably benign	Het
Sorl1	C	A	9: 41,925,746 (GRCm39)		probably null	Het
Sp110	C	G	1: 85,516,839 (GRCm39)	E219D	probably damaging	Het
Speer4a2	A	T	5: 26,289,791 (GRCm39)	I212N	probably damaging	Het
Tmem30b	G	A	12: 73,592,488 (GRCm39)	P209L	probably damaging	Het
Trbv12-2	G	T	6: 41,096,081 (GRCm39)	C52F	probably damaging	Het
Tsc2	T	A	17: 24,819,343 (GRCm39)	D1304V	probably benign	Het
Ugt2b36	T	C	5: 87,214,183 (GRCm39)	Y487C	probably damaging	Het
Vmn1r10	T	A	6: 57,090,811 (GRCm39)	N134K	probably damaging	Het
Wdr27	C	A	17: 15,141,016 (GRCm39)		probably null	Het
Wdr75	T	C	1: 45,855,638 (GRCm39)	F430L	probably damaging	Het
Zfp629	A	G	7: 127,211,299 (GRCm39)	I170T	probably damaging	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,848,978 (GRCm39)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,633,490 (GRCm39)	splice site	probably null
IGL00838:Ryr2	APN	13	11,583,389 (GRCm39)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,600,364 (GRCm39)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,750,388 (GRCm39)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,718,430 (GRCm39)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,653,371 (GRCm39)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,602,125 (GRCm39)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,571,571 (GRCm39)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,606,238 (GRCm39)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,756,922 (GRCm39)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,814,723 (GRCm39)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,866,090 (GRCm39)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,736,676 (GRCm39)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,736,647 (GRCm39)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,616,644 (GRCm39)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,606,202 (GRCm39)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,609,854 (GRCm39)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,707,563 (GRCm39)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,600,366 (GRCm39)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,616,728 (GRCm39)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,610,311 (GRCm39)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,569,436 (GRCm39)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,611,998 (GRCm39)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,762,450 (GRCm39)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,587,143 (GRCm39)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,807,648 (GRCm39)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,750,442 (GRCm39)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,774,645 (GRCm39)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,756,755 (GRCm39)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,745,274 (GRCm39)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,762,544 (GRCm39)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,634,382 (GRCm39)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,737,607 (GRCm39)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,620,130 (GRCm39)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,760,084 (GRCm39)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,760,560 (GRCm39)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,720,585 (GRCm39)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,569,397 (GRCm39)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,620,075 (GRCm39)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,753,206 (GRCm39)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,670,563 (GRCm39)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,610,076 (GRCm39)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,722,679 (GRCm39)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,933,205 (GRCm39)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,606,155 (GRCm39)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,774,721 (GRCm39)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,699,365 (GRCm39)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,658,788 (GRCm39)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,650,468 (GRCm39)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,868,036 (GRCm39)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,756,909 (GRCm39)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,583,449 (GRCm39)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,739,273 (GRCm39)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,787,302 (GRCm39)	missense	probably benign
IGL03410:Ryr2	APN	13	11,603,033 (GRCm39)	missense	probably damaging	0.99
Arruda	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,732,027 (GRCm39)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,680,848 (GRCm39)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,776,192 (GRCm39)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,722,682 (GRCm39)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,609,641 (GRCm39)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,839,265 (GRCm39)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,680,805 (GRCm39)	missense	probably benign
R0018:Ryr2	UTSW	13	11,610,109 (GRCm39)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,683,924 (GRCm39)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,583,361 (GRCm39)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,724,807 (GRCm39)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,729,434 (GRCm39)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,691,137 (GRCm39)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,787,442 (GRCm39)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,731,863 (GRCm39)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,683,725 (GRCm39)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,720,570 (GRCm39)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,848,981 (GRCm39)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,814,747 (GRCm39)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,653,329 (GRCm39)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,746,555 (GRCm39)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,650,445 (GRCm39)	missense	probably null
R0601:Ryr2	UTSW	13	11,720,519 (GRCm39)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,637,838 (GRCm39)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,739,219 (GRCm39)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,581,771 (GRCm39)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,753,012 (GRCm39)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,684,855 (GRCm39)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,960,867 (GRCm39)	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11,674,999 (GRCm39)	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,897,929 (GRCm39)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,702,765 (GRCm39)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,609,962 (GRCm39)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,729,389 (GRCm39)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,753,035 (GRCm39)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,741,908 (GRCm39)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,616,727 (GRCm39)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,569,478 (GRCm39)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,569,435 (GRCm39)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,800,029 (GRCm39)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,774,563 (GRCm39)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,809,449 (GRCm39)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,733,368 (GRCm39)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,618,665 (GRCm39)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,746,543 (GRCm39)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,602,328 (GRCm39)	splice site	probably null
R1728:Ryr2	UTSW	13	11,602,308 (GRCm39)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,805,153 (GRCm39)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,715,257 (GRCm39)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,610,167 (GRCm39)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,575,472 (GRCm39)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,602,202 (GRCm39)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,784,764 (GRCm39)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,746,586 (GRCm39)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,676,961 (GRCm39)	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11,753,242 (GRCm39)	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11,673,844 (GRCm39)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,765,818 (GRCm39)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,606,222 (GRCm39)	missense	probably benign
R1909:Ryr2	UTSW	13	11,715,235 (GRCm39)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,571,584 (GRCm39)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,746,609 (GRCm39)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,695,966 (GRCm39)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,600,288 (GRCm39)	splice site	probably null
R2018:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,610,622 (GRCm39)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,680,764 (GRCm39)	splice site	probably null
R2088:Ryr2	UTSW	13	11,677,115 (GRCm39)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,727,081 (GRCm39)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,575,493 (GRCm39)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,592,759 (GRCm39)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,720,679 (GRCm39)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,825,823 (GRCm39)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,677,146 (GRCm39)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,753,102 (GRCm39)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,753,128 (GRCm39)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,606,123 (GRCm39)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,816,734 (GRCm39)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,787,466 (GRCm39)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,603,045 (GRCm39)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,753,095 (GRCm39)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,787,313 (GRCm39)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,933,300 (GRCm39)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,707,568 (GRCm39)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,794,153 (GRCm39)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,602,323 (GRCm39)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,765,611 (GRCm39)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,664,698 (GRCm39)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,620,119 (GRCm39)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,731,952 (GRCm39)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,750,413 (GRCm39)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,121,301 (GRCm39)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,764,395 (GRCm39)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,765,571 (GRCm39)	splice site	probably null
R4668:Ryr2	UTSW	13	11,608,003 (GRCm39)	missense	probably benign
R4677:Ryr2	UTSW	13	11,721,553 (GRCm39)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,839,255 (GRCm39)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,610,119 (GRCm39)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,707,532 (GRCm39)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,731,884 (GRCm39)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,752,639 (GRCm39)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,671,933 (GRCm39)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,731,983 (GRCm39)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,670,584 (GRCm39)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,760,638 (GRCm39)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,683,706 (GRCm39)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,767,104 (GRCm39)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4933:Ryr2	UTSW	13	11,960,831 (GRCm39)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,756,897 (GRCm39)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,799,966 (GRCm39)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,610,192 (GRCm39)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,602,140 (GRCm39)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,650,422 (GRCm39)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,715,240 (GRCm39)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,727,129 (GRCm39)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,677,016 (GRCm39)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,675,175 (GRCm39)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,767,207 (GRCm39)	missense	probably benign
R5187:Ryr2	UTSW	13	11,787,338 (GRCm39)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,653,316 (GRCm39)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,787,323 (GRCm39)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,705,249 (GRCm39)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,571,544 (GRCm39)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,720,542 (GRCm39)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,720,587 (GRCm39)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,702,795 (GRCm39)	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,723,088 (GRCm39)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,616,691 (GRCm39)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,610,468 (GRCm39)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,774,722 (GRCm39)	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11,784,848 (GRCm39)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,575,460 (GRCm39)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,599,040 (GRCm39)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,805,218 (GRCm39)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,702,788 (GRCm39)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,675,008 (GRCm39)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,741,839 (GRCm39)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,677,124 (GRCm39)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,729,397 (GRCm39)	splice site	probably null
R6104:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,807,575 (GRCm39)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,683,903 (GRCm39)	missense	probably benign
R6208:Ryr2	UTSW	13	11,910,106 (GRCm39)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,848,964 (GRCm39)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,674,993 (GRCm39)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,776,282 (GRCm39)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,677,269 (GRCm39)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,848,893 (GRCm39)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,683,707 (GRCm39)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,724,951 (GRCm39)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,610,529 (GRCm39)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,753,348 (GRCm39)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,701,852 (GRCm39)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,741,816 (GRCm39)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,844,540 (GRCm39)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,842,445 (GRCm39)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,581,834 (GRCm39)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,816,129 (GRCm39)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,669,266 (GRCm39)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,727,052 (GRCm39)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,809,491 (GRCm39)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,839,286 (GRCm39)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,664,662 (GRCm39)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,684,873 (GRCm39)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,683,697 (GRCm39)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,655,213 (GRCm39)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,825,794 (GRCm39)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,816,063 (GRCm39)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,701,864 (GRCm39)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,774,643 (GRCm39)	missense	probably benign
R7189:Ryr2	UTSW	13	11,898,009 (GRCm39)	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11,680,799 (GRCm39)	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11,612,032 (GRCm39)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,753,080 (GRCm39)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,760,517 (GRCm39)	missense	probably benign
R7365:Ryr2	UTSW	13	11,655,161 (GRCm39)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,799,997 (GRCm39)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,750,506 (GRCm39)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,571,634 (GRCm39)	splice site	probably null
R7425:Ryr2	UTSW	13	11,720,530 (GRCm39)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,570,349 (GRCm39)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,767,168 (GRCm39)	missense	probably benign
R7460:Ryr2	UTSW	13	11,720,596 (GRCm39)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,609,762 (GRCm39)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,653,317 (GRCm39)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,752,871 (GRCm39)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,575,539 (GRCm39)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,776,213 (GRCm39)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,776,201 (GRCm39)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,705,219 (GRCm39)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,745,229 (GRCm39)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,765,897 (GRCm39)	missense	probably benign
R7797:Ryr2	UTSW	13	11,816,066 (GRCm39)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,842,493 (GRCm39)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,721,509 (GRCm39)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,610,610 (GRCm39)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,807,634 (GRCm39)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,661,313 (GRCm39)	splice site	probably null
R8008:Ryr2	UTSW	13	11,671,980 (GRCm39)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,603,026 (GRCm39)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,960,881 (GRCm39)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,618,584 (GRCm39)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,842,439 (GRCm39)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,610,392 (GRCm39)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,814,718 (GRCm39)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,683,821 (GRCm39)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,699,364 (GRCm39)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,673,894 (GRCm39)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,592,664 (GRCm39)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,575,479 (GRCm39)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,702,875 (GRCm39)	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11,701,833 (GRCm39)	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11,683,855 (GRCm39)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,750,509 (GRCm39)	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11,572,934 (GRCm39)	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,799,990 (GRCm39)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,814,768 (GRCm39)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,609,924 (GRCm39)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,609,672 (GRCm39)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,752,989 (GRCm39)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,610,817 (GRCm39)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,616,724 (GRCm39)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,618,741 (GRCm39)	intron	probably benign
R9116:Ryr2	UTSW	13	11,587,185 (GRCm39)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,669,292 (GRCm39)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,900,424 (GRCm39)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,610,772 (GRCm39)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,765,854 (GRCm39)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,721,578 (GRCm39)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,695,973 (GRCm39)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,809,459 (GRCm39)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,787,463 (GRCm39)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,752,680 (GRCm39)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,571,490 (GRCm39)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,602,101 (GRCm39)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,760,104 (GRCm39)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,737,646 (GRCm39)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,701,935 (GRCm39)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,609,785 (GRCm39)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,707,599 (GRCm39)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,718,387 (GRCm39)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,658,689 (GRCm39)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,613,497 (GRCm39)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,809,435 (GRCm39)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,765,759 (GRCm39)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- ATTTCTTGCCAACCCTGTGAGG -3'
(R):5'- TCAACCCACATATGGCCAGG -3'

Sequencing Primer
(F):5'- AGACAGCATCTGTTTGATTTGCTC -3'
(R):5'- GGCCATTGACGCCAACATGTC -3'

Posted On

2016-04-15