Incidental Mutation 'R4922:Rgl2'
ID 378727
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 042524-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R4922 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 34151749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 G T 4: 129,901,645 (GRCm39) C423F probably damaging Het
Akap11 A T 14: 78,750,220 (GRCm39) Y722* probably null Het
Albfm1 A G 5: 90,727,570 (GRCm39) H396R possibly damaging Het
Anxa3 A T 5: 96,968,288 (GRCm39) I114F probably damaging Het
Arfgef3 T A 10: 18,467,934 (GRCm39) R1755S probably damaging Het
Atf7ip A T 6: 136,537,039 (GRCm39) T91S possibly damaging Het
Bcl2 C A 1: 106,640,376 (GRCm39) A79S probably benign Het
Bltp1 T A 3: 37,041,314 (GRCm39) I2564K probably damaging Het
Bmerb1 A G 16: 13,804,683 (GRCm39) H10R possibly damaging Het
Bmp10 C T 6: 87,410,557 (GRCm39) P117S probably benign Het
Bmpr2 A G 1: 59,906,583 (GRCm39) T559A probably benign Het
Cd200r1 A T 16: 44,610,039 (GRCm39) Y86F probably damaging Het
Cemip T A 7: 83,596,308 (GRCm39) probably benign Het
Cfap251 T C 5: 123,394,116 (GRCm39) V335A probably benign Het
Cfap52 A G 11: 67,822,548 (GRCm39) probably null Het
Chml T C 1: 175,514,712 (GRCm39) H60R possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 24,991,095 (GRCm39) probably benign Het
Clec12a A G 6: 129,336,441 (GRCm39) Y201C probably damaging Het
Col15a1 T C 4: 47,258,719 (GRCm39) V370A probably benign Het
Cpsf3 T C 12: 21,351,538 (GRCm39) I353T probably damaging Het
Csf2rb T A 15: 78,230,667 (GRCm39) V470E probably benign Het
Cyp4a10 C A 4: 115,378,291 (GRCm39) Q126K probably benign Het
Dennd1b T C 1: 139,013,652 (GRCm39) S249P probably damaging Het
Dnase2a A G 8: 85,635,625 (GRCm39) probably null Het
Dpp10 T C 1: 123,305,882 (GRCm39) N490S probably benign Het
Drgx A T 14: 32,330,363 (GRCm39) N160I probably damaging Het
Enc1 C T 13: 97,382,243 (GRCm39) A251V probably benign Het
Fancd2 T C 6: 113,562,434 (GRCm39) V1258A probably benign Het
Fancm G A 12: 65,153,666 (GRCm39) probably null Het
Fbxo16 C T 14: 65,536,657 (GRCm39) T177I probably benign Het
Gm1965 T C 6: 89,123,525 (GRCm39) noncoding transcript Het
Hal A T 10: 93,339,401 (GRCm39) M497L probably damaging Het
Hectd4 T C 5: 121,497,378 (GRCm39) L3936S possibly damaging Het
Hs3st4 G T 7: 123,996,410 (GRCm39) G359W probably damaging Het
Il6st C T 13: 112,639,399 (GRCm39) P608L probably damaging Het
Kctd18 A C 1: 58,004,707 (GRCm39) probably benign Het
Kntc1 T A 5: 123,940,309 (GRCm39) S1636T probably damaging Het
Lrrn1 A T 6: 107,545,311 (GRCm39) S370C probably damaging Het
Mtcl1 A C 17: 66,655,474 (GRCm39) C968G probably benign Het
Mylip G A 13: 45,562,238 (GRCm39) A347T probably damaging Het
Naip2 T C 13: 100,291,468 (GRCm39) S1157G probably benign Het
Ncoa4-ps A G 12: 119,226,252 (GRCm39) noncoding transcript Het
Neu4 T A 1: 93,950,200 (GRCm39) V53E probably damaging Het
Nxpe3 T C 16: 55,680,687 (GRCm39) I302V probably benign Het
Or11i1 A T 3: 106,729,576 (GRCm39) C100S probably damaging Het
Or4c15b A T 2: 89,112,811 (GRCm39) L243Q possibly damaging Het
Otos T C 1: 92,572,090 (GRCm39) T79A probably damaging Het
Pde4a T C 9: 21,122,009 (GRCm39) I578T probably damaging Het
Pramel17 T A 4: 101,692,729 (GRCm39) M424L probably benign Het
Prex2 C T 1: 11,240,164 (GRCm39) P927S probably damaging Het
Prune2 A T 19: 17,100,116 (GRCm39) K1873N probably benign Het
Ptk7 C A 17: 46,887,417 (GRCm39) probably null Het
Reln T A 5: 22,200,585 (GRCm39) probably null Het
Rnf145 T A 11: 44,448,063 (GRCm39) probably benign Het
Ryr2 T C 13: 11,724,849 (GRCm39) E2488G probably damaging Het
Sgo2b A T 8: 64,379,664 (GRCm39) M1056K possibly damaging Het
Snapc4 A G 2: 26,259,245 (GRCm39) V635A probably benign Het
Snx19 T A 9: 30,348,763 (GRCm39) Y101N probably benign Het
Sorl1 C A 9: 41,925,746 (GRCm39) probably null Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Speer4a2 A T 5: 26,289,791 (GRCm39) I212N probably damaging Het
Tmem30b G A 12: 73,592,488 (GRCm39) P209L probably damaging Het
Trbv12-2 G T 6: 41,096,081 (GRCm39) C52F probably damaging Het
Tsc2 T A 17: 24,819,343 (GRCm39) D1304V probably benign Het
Ugt2b36 T C 5: 87,214,183 (GRCm39) Y487C probably damaging Het
Vmn1r10 T A 6: 57,090,811 (GRCm39) N134K probably damaging Het
Wdr27 C A 17: 15,141,016 (GRCm39) probably null Het
Wdr75 T C 1: 45,855,638 (GRCm39) F430L probably damaging Het
Zfp629 A G 7: 127,211,299 (GRCm39) I170T probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTGCTTCGGACAGGGTATG -3'
(R):5'- GATCTGAGGCTCTTAAGTGGCC -3'

Sequencing Primer
(F):5'- TTCGGACAGGGTATGCAGCAC -3'
(R):5'- TCTTAAGTGGCCAGGGACCAG -3'
Posted On 2016-04-15