Mutagenetix > Incidental Mutations

Incidental Mutation 'R4922:Ptk7'

378729

Institutional Source

Beutler Lab

Gene Symbol

Ptk7

Ensembl Gene

ENSMUSG00000023972

Gene Name

PTK7 protein tyrosine kinase 7

Synonyms

8430404F20Rik, mPTK7/CCK4, chz

MMRRC Submission

042524-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4922 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46564451-46629504 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to A at 46576491 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000043703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044442]

Predicted Effect

probably null
Transcript: ENSMUST00000044442

SMART Domains

Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	36	100	1.48e-6	SMART
IGc2	133	199	8.12e-13	SMART
IGc2	229	300	5.01e-4	SMART
IGc2	326	390	1.96e-6	SMART
IG	410	491	6.02e-7	SMART
IGc2	507	569	1.19e-10	SMART
IGc2	596	663	2.6e-11	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	788	1053	4.34e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Meta Mutation Damage Score

0.9485

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	A	G	16: 13,986,819	H10R	possibly damaging	Het
4932438A13Rik	T	A	3: 36,987,165	I2564K	probably damaging	Het
5830473C10Rik	A	G	5: 90,579,711	H396R	possibly damaging	Het
Adgrb2	G	T	4: 130,007,852	C423F	probably damaging	Het
Akap11	A	T	14: 78,512,780	Y722*	probably null	Het
Anxa3	A	T	5: 96,820,429	I114F	probably damaging	Het
Arfgef3	T	A	10: 18,592,186	R1755S	probably damaging	Het
Atf7ip	A	T	6: 136,560,041	T91S	possibly damaging	Het
B020004J07Rik	T	A	4: 101,835,532	M424L	probably benign	Het
Bcl2	C	A	1: 106,712,646	A79S	probably benign	Het
Bmp10	C	T	6: 87,433,575	P117S	probably benign	Het
Bmpr2	A	G	1: 59,867,424	T559A	probably benign	Het
Cd200r1	A	T	16: 44,789,676	Y86F	probably damaging	Het
Cemip	T	A	7: 83,947,100		probably benign	Het
Cfap52	A	G	11: 67,931,722		probably null	Het
Chml	T	C	1: 175,687,146	H60R	possibly damaging	Het
Cic	TCCCCC	TCCCCCCCC	7: 25,291,670		probably benign	Het
Clec12a	A	G	6: 129,359,478	Y201C	probably damaging	Het
Col15a1	T	C	4: 47,258,719	V370A	probably benign	Het
Cpsf3	T	C	12: 21,301,537	I353T	probably damaging	Het
Csf2rb	T	A	15: 78,346,467	V470E	probably benign	Het
Cyp4a10	C	A	4: 115,521,094	Q126K	probably benign	Het
Dennd1b	T	C	1: 139,085,914	S249P	probably damaging	Het
Dnase2a	A	G	8: 84,908,996		probably null	Het
Dpp10	T	C	1: 123,378,153	N490S	probably benign	Het
Enc1	C	T	13: 97,245,735	A251V	probably benign	Het
Fancd2	T	C	6: 113,585,473	V1258A	probably benign	Het
Fancm	G	A	12: 65,106,892		probably null	Het
Fbxo16	C	T	14: 65,299,208	T177I	probably benign	Het
Gm10471	A	T	5: 26,084,793	I212N	probably damaging	Het
Gm1965	T	C	6: 89,146,543		noncoding transcript	Het
Gm6768	A	G	12: 119,262,517		noncoding transcript	Het
Hal	A	T	10: 93,503,539	M497L	probably damaging	Het
Hectd4	T	C	5: 121,359,315	L3936S	possibly damaging	Het
Hs3st4	G	T	7: 124,397,187	G359W	probably damaging	Het
Il6st	C	T	13: 112,502,865	P608L	probably damaging	Het
Kctd18	A	C	1: 57,965,548		probably benign	Het
Kntc1	T	A	5: 123,802,246	S1636T	probably damaging	Het
Lrrn1	A	T	6: 107,568,350	S370C	probably damaging	Het
Mtcl1	A	C	17: 66,348,479	C968G	probably benign	Het
Mylip	G	A	13: 45,408,762	A347T	probably damaging	Het
Naip2	T	C	13: 100,154,960	S1157G	probably benign	Het
Neu4	T	A	1: 94,022,478	V53E	probably damaging	Het
Nxpe3	T	C	16: 55,860,324	I302V	probably benign	Het
Olfr1229	A	T	2: 89,282,467	L243Q	possibly damaging	Het
Olfr266	A	T	3: 106,822,260	C100S	probably damaging	Het
Otos	T	C	1: 92,644,368	T79A	probably damaging	Het
Pde4a	T	C	9: 21,210,713	I578T	probably damaging	Het
Prex2	C	T	1: 11,169,940	P927S	probably damaging	Het
Prrxl1	A	T	14: 32,608,406	N160I	probably damaging	Het
Prune2	A	T	19: 17,122,752	K1873N	probably benign	Het
Reln	T	A	5: 21,995,587		probably null	Het
Rgl2	A	G	17: 33,932,775		probably benign	Het
Rnf145	T	A	11: 44,557,236		probably benign	Het
Ryr2	T	C	13: 11,709,963	E2488G	probably damaging	Het
Sgo2b	A	T	8: 63,926,630	M1056K	possibly damaging	Het
Snapc4	A	G	2: 26,369,233	V635A	probably benign	Het
Snx19	T	A	9: 30,437,467	Y101N	probably benign	Het
Sorl1	C	A	9: 42,014,450		probably null	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tmem30b	G	A	12: 73,545,714	P209L	probably damaging	Het
Trbv12-2	G	T	6: 41,119,147	C52F	probably damaging	Het
Tsc2	T	A	17: 24,600,369	D1304V	probably benign	Het
Ugt2b36	T	C	5: 87,066,324	Y487C	probably damaging	Het
Vmn1r10	T	A	6: 57,113,826	N134K	probably damaging	Het
Wdr27	C	A	17: 14,920,754		probably null	Het
Wdr66	T	C	5: 123,256,053	V335A	probably benign	Het
Wdr75	T	C	1: 45,816,478	F430L	probably damaging	Het
Zfp629	A	G	7: 127,612,127	I170T	probably damaging	Het

Other mutations in Ptk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ptk7	APN	17	46574427	missense	probably damaging	1.00
IGL01064:Ptk7	APN	17	46573566	nonsense	probably null
IGL01444:Ptk7	APN	17	46565387	missense	probably damaging	1.00
IGL01477:Ptk7	APN	17	46576880	missense	possibly damaging	0.61
IGL01727:Ptk7	APN	17	46572548	missense	probably damaging	1.00
IGL01958:Ptk7	APN	17	46579427	missense	probably benign	0.37
IGL02496:Ptk7	APN	17	46590144	missense	probably benign	0.04
IGL02864:Ptk7	APN	17	46572733	missense	probably damaging	1.00
R0008:Ptk7	UTSW	17	46572762	splice site	probably benign
R0671:Ptk7	UTSW	17	46590312	missense	possibly damaging	0.94
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1549:Ptk7	UTSW	17	46572652	missense	probably damaging	1.00
R1635:Ptk7	UTSW	17	46573534	missense	possibly damaging	0.81
R1646:Ptk7	UTSW	17	46586297	missense	probably benign	0.44
R1846:Ptk7	UTSW	17	46576490	critical splice donor site	probably null
R1973:Ptk7	UTSW	17	46586807	nonsense	probably null
R2060:Ptk7	UTSW	17	46566238	missense	possibly damaging	0.83
R2155:Ptk7	UTSW	17	46579617	missense	probably benign	0.09
R2472:Ptk7	UTSW	17	46576848	missense	probably benign	0.35
R2937:Ptk7	UTSW	17	46572550	missense	probably damaging	0.99
R3824:Ptk7	UTSW	17	46565378	missense	probably damaging	1.00
R3845:Ptk7	UTSW	17	46586418	missense	probably benign	0.00
R4222:Ptk7	UTSW	17	46574463	missense	probably benign
R4671:Ptk7	UTSW	17	46574466	missense	probably benign
R5319:Ptk7	UTSW	17	46572677	missense	probably damaging	1.00
R5993:Ptk7	UTSW	17	46565370	missense	probably benign
R6254:Ptk7	UTSW	17	46572642	missense	probably damaging	1.00
R6352:Ptk7	UTSW	17	46576890	missense	probably benign	0.00
R6806:Ptk7	UTSW	17	46573528	missense	probably damaging	0.99
R7338:Ptk7	UTSW	17	46579599	missense	probably benign	0.00
R7394:Ptk7	UTSW	17	46591757	missense	probably damaging	1.00
R7709:Ptk7	UTSW	17	46571643	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CCTGATGTTACAGCTGTTGC -3'
(R):5'- ACAGCTCCGTTGCTCACTAC -3'

Sequencing Primer
(F):5'- TGTTGCCAGCGATGCAG -3'
(R):5'- CGTTGCTCACTACTTCCCAATC -3'

Posted On

2016-04-15