Mutagenetix > Incidental Mutations

Incidental Mutation 'R4922:Prune2'

378731

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

042524-MU

Accession Numbers

Genbank: NM_181348

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4922 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 17122752 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1873 (K1873N)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689]

Predicted Effect

probably benign
Transcript: ENSMUST00000087689
AA Change: K1873N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: K1873N

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226052

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	A	G	16: 13,986,819	H10R	possibly damaging	Het
4932438A13Rik	T	A	3: 36,987,165	I2564K	probably damaging	Het
5830473C10Rik	A	G	5: 90,579,711	H396R	possibly damaging	Het
Adgrb2	G	T	4: 130,007,852	C423F	probably damaging	Het
Akap11	A	T	14: 78,512,780	Y722*	probably null	Het
Anxa3	A	T	5: 96,820,429	I114F	probably damaging	Het
Arfgef3	T	A	10: 18,592,186	R1755S	probably damaging	Het
Atf7ip	A	T	6: 136,560,041	T91S	possibly damaging	Het
B020004J07Rik	T	A	4: 101,835,532	M424L	probably benign	Het
Bcl2	C	A	1: 106,712,646	A79S	probably benign	Het
Bmp10	C	T	6: 87,433,575	P117S	probably benign	Het
Bmpr2	A	G	1: 59,867,424	T559A	probably benign	Het
Cd200r1	A	T	16: 44,789,676	Y86F	probably damaging	Het
Cemip	T	A	7: 83,947,100		probably benign	Het
Cfap52	A	G	11: 67,931,722		probably null	Het
Chml	T	C	1: 175,687,146	H60R	possibly damaging	Het
Cic	TCCCCC	TCCCCCCCC	7: 25,291,670		probably benign	Het
Clec12a	A	G	6: 129,359,478	Y201C	probably damaging	Het
Col15a1	T	C	4: 47,258,719	V370A	probably benign	Het
Cpsf3	T	C	12: 21,301,537	I353T	probably damaging	Het
Csf2rb	T	A	15: 78,346,467	V470E	probably benign	Het
Cyp4a10	C	A	4: 115,521,094	Q126K	probably benign	Het
Dennd1b	T	C	1: 139,085,914	S249P	probably damaging	Het
Dnase2a	A	G	8: 84,908,996		probably null	Het
Dpp10	T	C	1: 123,378,153	N490S	probably benign	Het
Enc1	C	T	13: 97,245,735	A251V	probably benign	Het
Fancd2	T	C	6: 113,585,473	V1258A	probably benign	Het
Fancm	G	A	12: 65,106,892		probably null	Het
Fbxo16	C	T	14: 65,299,208	T177I	probably benign	Het
Gm10471	A	T	5: 26,084,793	I212N	probably damaging	Het
Gm1965	T	C	6: 89,146,543		noncoding transcript	Het
Gm6768	A	G	12: 119,262,517		noncoding transcript	Het
Hal	A	T	10: 93,503,539	M497L	probably damaging	Het
Hectd4	T	C	5: 121,359,315	L3936S	possibly damaging	Het
Hs3st4	G	T	7: 124,397,187	G359W	probably damaging	Het
Il6st	C	T	13: 112,502,865	P608L	probably damaging	Het
Kctd18	A	C	1: 57,965,548		probably benign	Het
Kntc1	T	A	5: 123,802,246	S1636T	probably damaging	Het
Lrrn1	A	T	6: 107,568,350	S370C	probably damaging	Het
Mtcl1	A	C	17: 66,348,479	C968G	probably benign	Het
Mylip	G	A	13: 45,408,762	A347T	probably damaging	Het
Naip2	T	C	13: 100,154,960	S1157G	probably benign	Het
Neu4	T	A	1: 94,022,478	V53E	probably damaging	Het
Nxpe3	T	C	16: 55,860,324	I302V	probably benign	Het
Olfr1229	A	T	2: 89,282,467	L243Q	possibly damaging	Het
Olfr266	A	T	3: 106,822,260	C100S	probably damaging	Het
Otos	T	C	1: 92,644,368	T79A	probably damaging	Het
Pde4a	T	C	9: 21,210,713	I578T	probably damaging	Het
Prex2	C	T	1: 11,169,940	P927S	probably damaging	Het
Prrxl1	A	T	14: 32,608,406	N160I	probably damaging	Het
Ptk7	C	A	17: 46,576,491		probably null	Het
Reln	T	A	5: 21,995,587		probably null	Het
Rgl2	A	G	17: 33,932,775		probably benign	Het
Rnf145	T	A	11: 44,557,236		probably benign	Het
Ryr2	T	C	13: 11,709,963	E2488G	probably damaging	Het
Sgo2b	A	T	8: 63,926,630	M1056K	possibly damaging	Het
Snapc4	A	G	2: 26,369,233	V635A	probably benign	Het
Snx19	T	A	9: 30,437,467	Y101N	probably benign	Het
Sorl1	C	A	9: 42,014,450		probably null	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tmem30b	G	A	12: 73,545,714	P209L	probably damaging	Het
Trbv12-2	G	T	6: 41,119,147	C52F	probably damaging	Het
Tsc2	T	A	17: 24,600,369	D1304V	probably benign	Het
Ugt2b36	T	C	5: 87,066,324	Y487C	probably damaging	Het
Vmn1r10	T	A	6: 57,113,826	N134K	probably damaging	Het
Wdr27	C	A	17: 14,920,754		probably null	Het
Wdr66	T	C	5: 123,256,053	V335A	probably benign	Het
Wdr75	T	C	1: 45,816,478	F430L	probably damaging	Het
Zfp629	A	G	7: 127,612,127	I170T	probably damaging	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTTGGCTTCTCAGCTGAC -3'
(R):5'- TTCTGCAGGAAGATCACCAG -3'

Sequencing Primer
(F):5'- TGGCTTCTCAGCTGACAGCAC -3'
(R):5'- TCACCAGCAGCAGGAGACATG -3'

Posted On

2016-04-15