Incidental Mutation 'R4923:Elf3'
ID 378734
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene Name E74-like factor 3
Synonyms ESE-1, jen, ESX
MMRRC Submission 042525-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.900) question?
Stock # R4923 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 135181312-135186210 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 135184473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
AlphaFold Q3UPW2
Predicted Effect probably benign
Transcript: ENSMUST00000003135
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180981
Predicted Effect probably benign
Transcript: ENSMUST00000185752
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188895
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
MGI Phenotype PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 A G 1: 173,287,372 (GRCm39) D124G probably benign Het
Akr1c6 T C 13: 4,504,494 (GRCm39) M293T probably damaging Het
Albfm1 A G 5: 90,709,158 (GRCm39) T23A probably benign Het
Ankhd1 A G 18: 36,722,505 (GRCm39) T343A probably damaging Het
Ano2 T C 6: 125,880,018 (GRCm39) probably benign Het
Arfgap2 G A 2: 91,104,004 (GRCm39) G353R probably damaging Het
Armc3 A G 2: 19,297,791 (GRCm39) probably null Het
Atp11b T C 3: 35,889,528 (GRCm39) probably null Het
Brd4 A G 17: 32,418,214 (GRCm39) M13T probably benign Het
Btd T A 14: 31,384,044 (GRCm39) M10K possibly damaging Het
C1s2 T C 6: 124,602,649 (GRCm39) K515E probably benign Het
Cars1 A T 7: 143,123,587 (GRCm39) Y455N probably damaging Het
Ccdc110 A G 8: 46,396,460 (GRCm39) S784G probably benign Het
Chic2 A G 5: 75,171,872 (GRCm39) probably benign Het
Chka A T 19: 3,942,105 (GRCm39) probably null Het
Chrne A G 11: 70,506,101 (GRCm39) I420T possibly damaging Het
Clstn1 T C 4: 149,729,486 (GRCm39) V747A probably benign Het
Cobll1 A G 2: 64,929,602 (GRCm39) S575P possibly damaging Het
Col6a6 A T 9: 105,666,147 (GRCm39) L3Q probably damaging Het
Comtd1 A T 14: 21,898,813 (GRCm39) probably benign Het
Cpsf2 T C 12: 101,948,243 (GRCm39) V13A probably benign Het
Creb3l4 T A 3: 90,149,521 (GRCm39) I115L probably benign Het
Cyp2j12 C T 4: 95,990,346 (GRCm39) A407T possibly damaging Het
Ddr2 A G 1: 169,825,498 (GRCm39) probably null Het
Dennd4c T C 4: 86,725,775 (GRCm39) L743P probably damaging Het
Egfl8 T C 17: 34,833,171 (GRCm39) T192A probably benign Het
Elapor1 C T 3: 108,379,284 (GRCm39) probably null Het
Entrep2 A G 7: 64,417,439 (GRCm39) S322P probably benign Het
Etv3 T G 3: 87,443,223 (GRCm39) L269R possibly damaging Het
Fah C A 7: 84,251,260 (GRCm39) probably benign Het
Fbll1 C A 11: 35,688,407 (GRCm39) L285F probably benign Het
Fcrla A T 1: 170,748,682 (GRCm39) F154I probably damaging Het
Fnip2 T A 3: 79,396,701 (GRCm39) probably null Het
Focad T C 4: 88,115,083 (GRCm39) probably benign Het
Gabrr1 T A 4: 33,162,820 (GRCm39) I462N possibly damaging Het
Gm57859 C A 11: 113,579,805 (GRCm39) T400K probably benign Het
Gnptab A G 10: 88,265,485 (GRCm39) T366A probably benign Het
Hnrnpu G A 1: 178,159,017 (GRCm39) probably benign Het
Il17ra T A 6: 120,454,406 (GRCm39) V299E possibly damaging Het
Impg1 G A 9: 80,252,360 (GRCm39) Q607* probably null Het
Impg1 T A 9: 80,252,827 (GRCm39) E374V probably damaging Het
Itgax C T 7: 127,747,700 (GRCm39) L1039F probably benign Het
Kcnk2 A T 1: 189,072,133 (GRCm39) V65D probably damaging Het
Kif20b A C 19: 34,918,611 (GRCm39) probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Lama5 T G 2: 179,825,942 (GRCm39) I2372L probably benign Het
Lilrb4a A G 10: 51,368,139 (GRCm39) T85A possibly damaging Het
Mapk13 C A 17: 28,997,197 (GRCm39) H330N probably benign Het
Mars1 C A 10: 127,132,549 (GRCm39) probably benign Het
Mdga1 C A 17: 30,057,052 (GRCm39) R818L probably damaging Het
Mdn1 T A 4: 32,671,608 (GRCm39) L476Q possibly damaging Het
Mup21 T C 4: 62,066,202 (GRCm39) E178G probably benign Het
Myg1 A G 15: 102,240,288 (GRCm39) N38S probably benign Het
Ncam1 A T 9: 49,416,779 (GRCm39) D837E probably benign Het
Ncam2 C T 16: 81,386,679 (GRCm39) P686L possibly damaging Het
Nck2 T C 1: 43,500,231 (GRCm39) probably benign Het
Nfya T C 17: 48,707,563 (GRCm39) probably benign Het
Npat A G 9: 53,482,330 (GRCm39) K1346R probably damaging Het
Odad2 C G 18: 7,181,787 (GRCm39) D846H probably damaging Het
Or12j3 G T 7: 139,952,920 (GRCm39) T201K probably benign Het
Or4a72 T C 2: 89,406,023 (GRCm39) T16A probably damaging Het
Or6c212 A G 10: 129,558,681 (GRCm39) V244A probably benign Het
Pde7b G T 10: 20,288,873 (GRCm39) Q325K probably damaging Het
Pla2r1 A T 2: 60,253,056 (GRCm39) M1345K probably benign Het
Prkcz T C 4: 155,441,946 (GRCm39) D62G probably damaging Het
Pros1 T A 16: 62,723,935 (GRCm39) C228S possibly damaging Het
Ptprc A G 1: 138,006,236 (GRCm39) M782T possibly damaging Het
Rcn1 T C 2: 105,219,518 (GRCm39) D225G probably benign Het
Recql4 G A 15: 76,594,381 (GRCm39) R46C probably damaging Het
Rnf220 C T 4: 117,346,797 (GRCm39) R205Q possibly damaging Het
Samd13 T C 3: 146,368,502 (GRCm39) D11G probably benign Het
Scp2d1 T A 2: 144,666,030 (GRCm39) I123K probably benign Het
Skap1 A T 11: 96,644,870 (GRCm39) Y311F probably damaging Het
Slc2a10 T C 2: 165,356,676 (GRCm39) I112T possibly damaging Het
Slc34a1 G A 13: 24,003,078 (GRCm39) V243M probably benign Het
Slc39a2 G A 14: 52,132,711 (GRCm39) G218D probably damaging Het
Sos1 T C 17: 80,742,381 (GRCm39) N382S probably benign Het
Spam1 C T 6: 24,796,655 (GRCm39) T202I probably damaging Het
Tas2r138 T A 6: 40,589,820 (GRCm39) Q142L possibly damaging Het
Tec T A 5: 72,939,365 (GRCm39) R217* probably null Het
Tmeff2 T A 1: 50,969,804 (GRCm39) V90D probably benign Het
Tmem119 T C 5: 113,933,405 (GRCm39) Y132C probably damaging Het
Topbp1 A G 9: 103,190,035 (GRCm39) I204V probably benign Het
Trappc14 A T 5: 138,260,641 (GRCm39) probably benign Het
Ttn A T 2: 76,601,232 (GRCm39) I17001N probably damaging Het
Vit T A 17: 78,894,270 (GRCm39) M224K probably benign Het
Vmn1r179 T G 7: 23,628,491 (GRCm39) H227Q possibly damaging Het
Vmn1r84 T C 7: 12,095,743 (GRCm39) N305D probably benign Het
Vmn2r61 A G 7: 41,916,520 (GRCm39) N378D probably damaging Het
Vmn2r87 A G 10: 130,314,435 (GRCm39) Y384H probably damaging Het
Wiz C T 17: 32,580,570 (GRCm39) A294T probably benign Het
Xdh C A 17: 74,231,931 (GRCm39) V260L possibly damaging Het
Xirp2 A G 2: 67,343,237 (GRCm39) K1826R probably benign Het
Zfp445 A C 9: 122,681,358 (GRCm39) I861R probably benign Het
Zfp691 T C 4: 119,027,999 (GRCm39) T78A probably benign Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135,185,445 (GRCm39) missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135,182,750 (GRCm39) missense probably damaging 1.00
IGL03018:Elf3 APN 1 135,183,803 (GRCm39) missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135,182,691 (GRCm39) missense probably damaging 1.00
P0026:Elf3 UTSW 1 135,183,711 (GRCm39) critical splice donor site probably null
R0087:Elf3 UTSW 1 135,184,875 (GRCm39) missense probably damaging 1.00
R1842:Elf3 UTSW 1 135,184,531 (GRCm39) missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135,184,875 (GRCm39) missense probably damaging 1.00
R2081:Elf3 UTSW 1 135,184,814 (GRCm39) missense probably benign 0.12
R4049:Elf3 UTSW 1 135,182,015 (GRCm39) missense probably benign 0.21
R4467:Elf3 UTSW 1 135,184,582 (GRCm39) missense probably damaging 1.00
R4630:Elf3 UTSW 1 135,184,478 (GRCm39) intron probably benign
R4715:Elf3 UTSW 1 135,185,490 (GRCm39) missense probably damaging 1.00
R5226:Elf3 UTSW 1 135,184,977 (GRCm39) missense probably benign 0.07
R5422:Elf3 UTSW 1 135,182,778 (GRCm39) missense probably damaging 0.98
R5706:Elf3 UTSW 1 135,184,220 (GRCm39) missense probably benign 0.01
R7115:Elf3 UTSW 1 135,184,856 (GRCm39) missense probably damaging 1.00
R7644:Elf3 UTSW 1 135,184,244 (GRCm39) missense possibly damaging 0.89
R7855:Elf3 UTSW 1 135,182,090 (GRCm39) missense probably damaging 1.00
R7940:Elf3 UTSW 1 135,184,866 (GRCm39) missense probably damaging 1.00
R8315:Elf3 UTSW 1 135,184,314 (GRCm39) missense probably benign 0.00
R8723:Elf3 UTSW 1 135,185,385 (GRCm39) missense possibly damaging 0.95
R8724:Elf3 UTSW 1 135,182,098 (GRCm39) missense probably damaging 1.00
R8906:Elf3 UTSW 1 135,182,678 (GRCm39) missense probably damaging 1.00
R8960:Elf3 UTSW 1 135,182,813 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGGCAAAAGGACTTCC -3'
(R):5'- AGTAAGTCTAGGCTGGGAGC -3'

Sequencing Primer
(F):5'- GGACTTCCCTGATCTGAGAAAAG -3'
(R):5'- CGGAACCATGGTCAGTGAC -3'
Posted On 2016-04-15