Incidental Mutation 'R4923:Focad'
ID378762
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission 042525-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R4923 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 88196846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: S429P
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: S429P

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159342
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Dennd4c T C 4: 86,807,538 L743P probably damaging Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fcrla A T 1: 170,921,113 F154I probably damaging Het
Fnip2 T A 3: 79,489,394 probably null Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Itgax C T 7: 128,148,528 L1039F probably benign Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lama5 T G 2: 180,184,149 I2372L probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mapk13 C A 17: 28,778,223 H330N probably benign Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc2a10 T C 2: 165,514,756 I112T possibly damaging Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xdh C A 17: 73,924,936 V260L possibly damaging Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
R7789:Focad UTSW 4 88229406 missense unknown
R7880:Focad UTSW 4 88401170 missense unknown
R7887:Focad UTSW 4 88182616 missense probably damaging 1.00
R7963:Focad UTSW 4 88401170 missense unknown
R7970:Focad UTSW 4 88182616 missense probably damaging 1.00
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATTTGGCAGGACCTCAAAGTATC -3'
(R):5'- ACCTGAGAGGAATCTGCTTGAG -3'

Sequencing Primer
(F):5'- TGCATTATAAAATGGGTGAATGTCAG -3'
(R):5'- AGGAATCTGCTTGAGCTAACTG -3'
Posted On2016-04-15