Incidental Mutation 'R4923:Mapk13'
ID378822
Institutional Source Beutler Lab
Gene Symbol Mapk13
Ensembl Gene ENSMUSG00000004864
Gene Namemitogen-activated protein kinase 13
Synonymsp38 delta MAP kinase, SAPK4, Serk4
MMRRC Submission 042525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R4923 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28769307-28778698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28778223 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 330 (H330N)
Ref Sequence ENSEMBL: ENSMUSP00000004986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004986] [ENSMUST00000129096]
Predicted Effect probably benign
Transcript: ENSMUST00000004986
AA Change: H330N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004986
Gene: ENSMUSG00000004864
AA Change: H330N

DomainStartEndE-ValueType
S_TKc 25 308 8.72e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124099
Predicted Effect probably benign
Transcript: ENSMUST00000129096
SMART Domains Protein: ENSMUSP00000115659
Gene: ENSMUSG00000004864

DomainStartEndE-ValueType
Pfam:Pkinase 25 209 1.1e-49 PFAM
Pfam:Pkinase_Tyr 27 210 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133786
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit improved glucose tolerance, increased insulin secretion, decreased blood glucose, and decreased susceptibility to diet- or chemically-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Dennd4c T C 4: 86,807,538 L743P probably damaging Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fcrla A T 1: 170,921,113 F154I probably damaging Het
Fnip2 T A 3: 79,489,394 probably null Het
Focad T C 4: 88,196,846 probably benign Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Itgax C T 7: 128,148,528 L1039F probably benign Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lama5 T G 2: 180,184,149 I2372L probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc2a10 T C 2: 165,514,756 I112T possibly damaging Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xdh C A 17: 73,924,936 V260L possibly damaging Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Mapk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Mapk13 APN 17 28776405 missense probably damaging 1.00
IGL01918:Mapk13 APN 17 28775330 missense probably damaging 1.00
IGL02265:Mapk13 APN 17 28777718 splice site probably benign
IGL02451:Mapk13 APN 17 28776413 missense probably damaging 1.00
IGL02977:Mapk13 APN 17 28776348 missense probably damaging 1.00
IGL03118:Mapk13 APN 17 28777735 missense probably benign 0.14
IGL03188:Mapk13 APN 17 28776583 intron probably benign
R0501:Mapk13 UTSW 17 28776353 missense probably damaging 1.00
R0538:Mapk13 UTSW 17 28775255 missense probably damaging 1.00
R2240:Mapk13 UTSW 17 28778111 missense probably damaging 0.98
R4368:Mapk13 UTSW 17 28777565 splice site probably null
R4613:Mapk13 UTSW 17 28769452 missense probably damaging 1.00
R4649:Mapk13 UTSW 17 28778487 nonsense probably null
R4684:Mapk13 UTSW 17 28770049 missense probably damaging 1.00
R4796:Mapk13 UTSW 17 28775554 missense probably damaging 1.00
R4863:Mapk13 UTSW 17 28776310 missense probably damaging 1.00
R5220:Mapk13 UTSW 17 28778491 missense probably benign 0.00
R5247:Mapk13 UTSW 17 28777751 missense probably benign 0.01
R5370:Mapk13 UTSW 17 28776352 nonsense probably null
R6838:Mapk13 UTSW 17 28777561 splice site probably null
R6843:Mapk13 UTSW 17 28775453 intron probably null
R7187:Mapk13 UTSW 17 28776387 missense probably damaging 1.00
Z1088:Mapk13 UTSW 17 28777533 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCACTAGGTGCAAGGCTCAC -3'
(R):5'- TGGGAGAGTTCACCCTCAGATAG -3'

Sequencing Primer
(F):5'- TCACCAGGTGCAATGCTC -3'
(R):5'- GTTCACCCTCAGATAGTAGAGTAG -3'
Posted On2016-04-15