Incidental Mutation 'R4923:Xdh'
ID378829
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 042525-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R4923 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73924936 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 260 (V260L)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024866
AA Change: V260L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V260L

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Dennd4c T C 4: 86,807,538 L743P probably damaging Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fcrla A T 1: 170,921,113 F154I probably damaging Het
Fnip2 T A 3: 79,489,394 probably null Het
Focad T C 4: 88,196,846 probably benign Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Itgax C T 7: 128,148,528 L1039F probably benign Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lama5 T G 2: 180,184,149 I2372L probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mapk13 C A 17: 28,778,223 H330N probably benign Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc2a10 T C 2: 165,514,756 I112T possibly damaging Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCAAAGCCGATGTCTC -3'
(R):5'- TCAGTAAACAGGTTGACCCC -3'

Sequencing Primer
(F):5'- CGATGTCTCGGGAGTCCATG -3'
(R):5'- GTAAACAGGTTGACCCCCTTGC -3'
Posted On2016-04-15