Mutagenetix > Incidental Mutations

Incidental Mutation 'R4924:Kdm5b'

378837

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

042526-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.343) question?

Stock #

R4924 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 134631351 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1538 (K1538E)

Ref Sequence

ENSEMBL: ENSMUSP00000038138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

Predicted Effect

probably benign
Transcript: ENSMUST00000047714
AA Change: K1538E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: K1538E

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112198

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191572

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,011,525	H625Y	probably damaging	Het
Adamts4	C	T	1: 171,259,074	R812W	probably damaging	Het
Ajuba	A	C	14: 54,571,599		probably null	Het
Aox2	T	A	1: 58,305,344	V532D	probably damaging	Het
Arpc1b	G	A	5: 145,126,815	S295N	probably benign	Het
Baiap2	A	G	11: 119,997,024	S335G	probably damaging	Het
BC051142	C	T	17: 34,459,977	P221L	probably damaging	Het
Brap	T	G	5: 121,665,255	N155K	probably damaging	Het
Btn1a1	A	G	13: 23,464,226		probably benign	Het
Ccl12	G	A	11: 82,102,649	V38I	probably benign	Het
Cemip	T	C	7: 83,952,938	Y881C	probably damaging	Het
Cep128	T	C	12: 91,022,400		silent	Het
Chd5	A	C	4: 152,366,429	D670A	possibly damaging	Het
Cmip	T	C	8: 117,257,255	Y52H	probably benign	Het
Dmtn	A	G	14: 70,617,959	I30T	probably benign	Het
Dscaml1	T	A	9: 45,745,189	M1609K	probably damaging	Het
Edar	C	A	10: 58,629,375	E55D	probably damaging	Het
Ehmt1	A	T	2: 24,839,722	I601N	probably damaging	Het
Fam120a	A	T	13: 48,902,096	N705K	probably benign	Het
Gm21718	G	T	14: 51,312,835		noncoding transcript	Het
Gnaz	A	G	10: 74,991,713	D99G	probably benign	Het
Helz	G	A	11: 107,602,339	G196D	probably damaging	Het
Hif1a	T	C	12: 73,939,557	S341P	probably damaging	Het
Hivep1	G	T	13: 42,158,316	S1344I	probably benign	Het
Hspa1l	T	A	17: 34,977,856	Y290*	probably null	Het
Ift81	A	G	5: 122,594,616	L285S	possibly damaging	Het
Inpp4b	T	A	8: 82,122,624	N891K	probably damaging	Het
Irx6	C	T	8: 92,678,353	T283M	probably benign	Het
Kif13a	A	G	13: 46,929,599	V8A	probably damaging	Het
Krtap15	T	A	16: 88,829,148	N34K	probably damaging	Het
Lama2	T	G	10: 27,369,141	I215L	probably damaging	Het
Ldlrad3	C	T	2: 102,069,983	R58H	possibly damaging	Het
Lvrn	C	T	18: 46,894,725	P869L	probably damaging	Het
Myo1d	A	G	11: 80,674,678	F411S	probably damaging	Het
Myo5b	T	A	18: 74,695,384	H702Q	probably benign	Het
Nat8f4	G	T	6: 85,901,419	Q41K	probably benign	Het
Nckap5	C	A	1: 126,027,028	E596*	probably null	Het
Nek10	T	A	14: 14,846,594		probably null	Het
Notch3	T	C	17: 32,144,731	Y1145C	probably damaging	Het
Nr4a2	A	T	2: 57,112,023	H76Q	probably benign	Het
Nup98	T	C	7: 102,134,978	Q1049R	probably damaging	Het
Olfr1080	A	T	2: 86,553,509	F205Y	probably damaging	Het
Olfr1298	A	T	2: 111,645,776	S74T	possibly damaging	Het
Olfr172	T	A	16: 58,760,619	R186*	probably null	Het
Pepd	T	C	7: 35,020,984	Y231H	probably benign	Het
Plagl1	G	T	10: 13,127,557	A190S	possibly damaging	Het
Plat	T	A	8: 22,778,253	I345N	probably damaging	Het
Pnmt	A	G	11: 98,387,460	E120G	probably damaging	Het
Prkrip1	C	A	5: 136,198,943		probably null	Het
Pygm	G	A	19: 6,393,724	A572T	probably damaging	Het
Rbm4b	T	C	19: 4,757,372	F39L	probably damaging	Het
Rpe65	A	G	3: 159,622,631	H388R	probably benign	Het
Scn4a	G	T	11: 106,320,088	A1701E	possibly damaging	Het
Sdk2	C	A	11: 113,857,758	W616L	probably damaging	Het
Serpina3m	T	A	12: 104,391,470	S218T	probably benign	Het
Siglece	C	T	7: 43,659,873	R87H	probably damaging	Het
Sim1	C	A	10: 50,909,902	L284M	probably damaging	Het
Smok3c	G	T	5: 138,065,582	E444*	probably null	Het
Snx4	T	C	16: 33,294,730	V427A	probably benign	Het
Srp68	A	T	11: 116,260,858	V304E	probably damaging	Het
Stag1	A	T	9: 100,796,755	H243L	possibly damaging	Het
Stx6	T	C	1: 155,173,991	V14A	probably damaging	Het
Sv2b	T	A	7: 75,136,421	Y417F	probably benign	Het
Tas2r103	A	G	6: 133,036,198	Y302H	probably benign	Het
Thop1	T	C	10: 81,080,194	S404P	probably benign	Het
Trp53bp1	G	T	2: 121,221,220	C988*	probably null	Het
Ube3c	A	G	5: 29,631,271	E630G	possibly damaging	Het
Usf3	T	C	16: 44,217,355	S733P	probably benign	Het
Vmn1r195	A	G	13: 22,279,019	T220A	probably benign	Het
Vmn1r201	A	T	13: 22,474,712	H32L	probably benign	Het
Wnt2	A	G	6: 18,023,240	C137R	probably damaging	Het
Ythdc2	T	C	18: 44,847,804	S489P	probably damaging	Het
Zfp248	A	G	6: 118,429,072	C418R	probably damaging	Het
Zfp946	T	G	17: 22,455,521	F419V	probably damaging	Het
Zfp994	C	T	17: 22,200,757	E404K	probably damaging	Het
Zfpm1	T	C	8: 122,334,608	V304A	possibly damaging	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1221:Kdm5b	UTSW	1	134599091	missense	probably damaging	0.98
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2059:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3417:Kdm5b	UTSW	1	134587977	missense	probably damaging	1.00
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R3983:Kdm5b	UTSW	1	134631304	missense	possibly damaging	0.91
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5399:Kdm5b	UTSW	1	134622098	splice site	probably null
R5529:Kdm5b	UTSW	1	134588003	missense	probably damaging	1.00
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7335:Kdm5b	UTSW	1	134560439	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
R8527:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8542:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCCGATTTTGAATGGCATTGTTTC -3'
(R):5'- TCGTAATCAGTAGAGACCCCTG -3'

Sequencing Primer
(F):5'- GAATGGCATTGTTTCCTCTGAAC -3'
(R):5'- GTCAGCATTTTAAACTTCAACAACC -3'

Posted On

2016-04-15