Incidental Mutation 'R4924:Adamts4'
ID378839
Institutional Source Beutler Lab
Gene Symbol Adamts4
Ensembl Gene ENSMUSG00000006403
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonymsaggrecanase-1, ADAM-TS4
MMRRC Submission 042526-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4924 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171250421-171260637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 171259074 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 812 (R812W)
Ref Sequence ENSEMBL: ENSMUSP00000151387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111314] [ENSMUST00000111315] [ENSMUST00000219033]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111314
AA Change: R615W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106946
Gene: ENSMUSG00000006403
AA Change: R615W

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Reprolysin_5 27 214 1.8e-12 PFAM
Pfam:Reprolysin 29 239 1e-19 PFAM
Pfam:Reprolysin_4 33 235 1.2e-10 PFAM
Pfam:Reprolysin_3 50 183 5.4e-12 PFAM
Pfam:Reprolysin_2 50 229 1.9e-9 PFAM
Blast:ACR 240 319 4e-24 BLAST
TSP1 334 386 3.52e-14 SMART
Pfam:ADAM_spacer1 497 614 5.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111315
AA Change: R800W

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106947
Gene: ENSMUSG00000006403
AA Change: R800W

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Pep_M12B_propep 54 177 5.6e-17 PFAM
Pfam:Reprolysin_5 212 399 6.5e-12 PFAM
Pfam:Reprolysin 214 424 4.6e-19 PFAM
Pfam:Reprolysin_4 219 420 4.6e-10 PFAM
Pfam:Reprolysin_3 235 368 1.9e-11 PFAM
Pfam:Reprolysin_2 236 414 7.2e-9 PFAM
Blast:ACR 425 504 4e-24 BLAST
TSP1 519 571 3.52e-14 SMART
Pfam:ADAM_spacer1 682 799 1.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219033
AA Change: R812W

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active zinc-dependent aggrecanase enzyme that degrades cartilage. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological abnormalities. However, they do display impaired coordination and an increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,011,525 H625Y probably damaging Het
Ajuba A C 14: 54,571,599 probably null Het
Aox2 T A 1: 58,305,344 V532D probably damaging Het
Arpc1b G A 5: 145,126,815 S295N probably benign Het
Baiap2 A G 11: 119,997,024 S335G probably damaging Het
BC051142 C T 17: 34,459,977 P221L probably damaging Het
Brap T G 5: 121,665,255 N155K probably damaging Het
Btn1a1 A G 13: 23,464,226 probably benign Het
Ccl12 G A 11: 82,102,649 V38I probably benign Het
Cemip T C 7: 83,952,938 Y881C probably damaging Het
Cep128 T C 12: 91,022,400 silent Het
Chd5 A C 4: 152,366,429 D670A possibly damaging Het
Cmip T C 8: 117,257,255 Y52H probably benign Het
Dmtn A G 14: 70,617,959 I30T probably benign Het
Dscaml1 T A 9: 45,745,189 M1609K probably damaging Het
Edar C A 10: 58,629,375 E55D probably damaging Het
Ehmt1 A T 2: 24,839,722 I601N probably damaging Het
Fam120a A T 13: 48,902,096 N705K probably benign Het
Gm21718 G T 14: 51,312,835 noncoding transcript Het
Gnaz A G 10: 74,991,713 D99G probably benign Het
Helz G A 11: 107,602,339 G196D probably damaging Het
Hif1a T C 12: 73,939,557 S341P probably damaging Het
Hivep1 G T 13: 42,158,316 S1344I probably benign Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Ift81 A G 5: 122,594,616 L285S possibly damaging Het
Inpp4b T A 8: 82,122,624 N891K probably damaging Het
Irx6 C T 8: 92,678,353 T283M probably benign Het
Kdm5b A G 1: 134,631,351 K1538E probably benign Het
Kif13a A G 13: 46,929,599 V8A probably damaging Het
Krtap15 T A 16: 88,829,148 N34K probably damaging Het
Lama2 T G 10: 27,369,141 I215L probably damaging Het
Ldlrad3 C T 2: 102,069,983 R58H possibly damaging Het
Lvrn C T 18: 46,894,725 P869L probably damaging Het
Myo1d A G 11: 80,674,678 F411S probably damaging Het
Myo5b T A 18: 74,695,384 H702Q probably benign Het
Nat8f4 G T 6: 85,901,419 Q41K probably benign Het
Nckap5 C A 1: 126,027,028 E596* probably null Het
Nek10 T A 14: 14,846,594 probably null Het
Notch3 T C 17: 32,144,731 Y1145C probably damaging Het
Nr4a2 A T 2: 57,112,023 H76Q probably benign Het
Nup98 T C 7: 102,134,978 Q1049R probably damaging Het
Olfr1080 A T 2: 86,553,509 F205Y probably damaging Het
Olfr1298 A T 2: 111,645,776 S74T possibly damaging Het
Olfr172 T A 16: 58,760,619 R186* probably null Het
Pepd T C 7: 35,020,984 Y231H probably benign Het
Plagl1 G T 10: 13,127,557 A190S possibly damaging Het
Plat T A 8: 22,778,253 I345N probably damaging Het
Pnmt A G 11: 98,387,460 E120G probably damaging Het
Prkrip1 C A 5: 136,198,943 probably null Het
Pygm G A 19: 6,393,724 A572T probably damaging Het
Rbm4b T C 19: 4,757,372 F39L probably damaging Het
Rpe65 A G 3: 159,622,631 H388R probably benign Het
Scn4a G T 11: 106,320,088 A1701E possibly damaging Het
Sdk2 C A 11: 113,857,758 W616L probably damaging Het
Serpina3m T A 12: 104,391,470 S218T probably benign Het
Siglece C T 7: 43,659,873 R87H probably damaging Het
Sim1 C A 10: 50,909,902 L284M probably damaging Het
Smok3c G T 5: 138,065,582 E444* probably null Het
Snx4 T C 16: 33,294,730 V427A probably benign Het
Srp68 A T 11: 116,260,858 V304E probably damaging Het
Stag1 A T 9: 100,796,755 H243L possibly damaging Het
Stx6 T C 1: 155,173,991 V14A probably damaging Het
Sv2b T A 7: 75,136,421 Y417F probably benign Het
Tas2r103 A G 6: 133,036,198 Y302H probably benign Het
Thop1 T C 10: 81,080,194 S404P probably benign Het
Trp53bp1 G T 2: 121,221,220 C988* probably null Het
Ube3c A G 5: 29,631,271 E630G possibly damaging Het
Usf3 T C 16: 44,217,355 S733P probably benign Het
Vmn1r195 A G 13: 22,279,019 T220A probably benign Het
Vmn1r201 A T 13: 22,474,712 H32L probably benign Het
Wnt2 A G 6: 18,023,240 C137R probably damaging Het
Ythdc2 T C 18: 44,847,804 S489P probably damaging Het
Zfp248 A G 6: 118,429,072 C418R probably damaging Het
Zfp946 T G 17: 22,455,521 F419V probably damaging Het
Zfp994 C T 17: 22,200,757 E404K probably damaging Het
Zfpm1 T C 8: 122,334,608 V304A possibly damaging Het
Other mutations in Adamts4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Adamts4 APN 1 171252850 missense probably damaging 1.00
IGL02496:Adamts4 APN 1 171250943 missense probably benign 0.00
IGL02510:Adamts4 APN 1 171251390 missense probably benign 0.08
IGL02695:Adamts4 APN 1 171252634 missense probably damaging 1.00
IGL02952:Adamts4 APN 1 171251348 missense probably damaging 1.00
IGL03010:Adamts4 APN 1 171251416 missense probably damaging 1.00
IGL03304:Adamts4 APN 1 171252869 splice site probably benign
PIT4305001:Adamts4 UTSW 1 171259041 missense probably benign
R0331:Adamts4 UTSW 1 171250972 missense probably benign 0.00
R1302:Adamts4 UTSW 1 171253183 missense probably damaging 1.00
R1460:Adamts4 UTSW 1 171256440 splice site probably benign
R1502:Adamts4 UTSW 1 171258990 missense probably damaging 1.00
R1544:Adamts4 UTSW 1 171252742 missense probably benign 0.09
R1815:Adamts4 UTSW 1 171256336 missense probably damaging 0.99
R1982:Adamts4 UTSW 1 171258934 missense probably benign 0.00
R1986:Adamts4 UTSW 1 171256675 missense possibly damaging 0.94
R2281:Adamts4 UTSW 1 171256229 missense probably damaging 1.00
R4261:Adamts4 UTSW 1 171259104 missense probably benign 0.01
R4750:Adamts4 UTSW 1 171251066 missense probably benign
R4868:Adamts4 UTSW 1 171252431 intron probably benign
R5418:Adamts4 UTSW 1 171252574 missense probably damaging 1.00
R5468:Adamts4 UTSW 1 171252609 missense probably benign
R5566:Adamts4 UTSW 1 171250850 start codon destroyed probably null 0.90
R5781:Adamts4 UTSW 1 171251015 missense possibly damaging 0.89
R6043:Adamts4 UTSW 1 171252601 missense probably damaging 1.00
R6053:Adamts4 UTSW 1 171252715 missense possibly damaging 0.85
R6187:Adamts4 UTSW 1 171250993 missense probably damaging 1.00
R6614:Adamts4 UTSW 1 171256624 missense probably benign 0.07
R6976:Adamts4 UTSW 1 171252308 intron probably benign
R7291:Adamts4 UTSW 1 171256528 missense probably benign
R7363:Adamts4 UTSW 1 171259039 missense probably benign 0.40
R7490:Adamts4 UTSW 1 171256600 nonsense probably null
R7797:Adamts4 UTSW 1 171257818 missense probably damaging 1.00
X0062:Adamts4 UTSW 1 171256549 missense probably damaging 1.00
Z1176:Adamts4 UTSW 1 171258783 missense probably benign 0.00
Z1176:Adamts4 UTSW 1 171258784 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AATGGTGAATACACGCTGATGC -3'
(R):5'- CCCTACTGTGTTTTAGCAGGAGG -3'

Sequencing Primer
(F):5'- TGAATACACGCTGATGCCCTCC -3'
(R):5'- GGCAGTTGCAGAAGCCTG -3'
Posted On2016-04-15