Incidental Mutation 'R4924:Trp53bp1'
ID378845
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission 042526-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4924 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 121221220 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 988 (C988*)
Ref Sequence ENSEMBL: ENSMUSP00000114457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000131245]
Predicted Effect probably null
Transcript: ENSMUST00000110647
AA Change: C1028*
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: C1028*

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110648
AA Change: C1028*
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: C1028*

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124411
Predicted Effect probably null
Transcript: ENSMUST00000124554
AA Change: C7*
Predicted Effect probably null
Transcript: ENSMUST00000131245
AA Change: C988*
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: C988*

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140582
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156493
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,011,525 H625Y probably damaging Het
Adamts4 C T 1: 171,259,074 R812W probably damaging Het
Ajuba A C 14: 54,571,599 probably null Het
Aox2 T A 1: 58,305,344 V532D probably damaging Het
Arpc1b G A 5: 145,126,815 S295N probably benign Het
Baiap2 A G 11: 119,997,024 S335G probably damaging Het
BC051142 C T 17: 34,459,977 P221L probably damaging Het
Brap T G 5: 121,665,255 N155K probably damaging Het
Btn1a1 A G 13: 23,464,226 probably benign Het
Ccl12 G A 11: 82,102,649 V38I probably benign Het
Cemip T C 7: 83,952,938 Y881C probably damaging Het
Cep128 T C 12: 91,022,400 silent Het
Chd5 A C 4: 152,366,429 D670A possibly damaging Het
Cmip T C 8: 117,257,255 Y52H probably benign Het
Dmtn A G 14: 70,617,959 I30T probably benign Het
Dscaml1 T A 9: 45,745,189 M1609K probably damaging Het
Edar C A 10: 58,629,375 E55D probably damaging Het
Ehmt1 A T 2: 24,839,722 I601N probably damaging Het
Fam120a A T 13: 48,902,096 N705K probably benign Het
Gm21718 G T 14: 51,312,835 noncoding transcript Het
Gnaz A G 10: 74,991,713 D99G probably benign Het
Helz G A 11: 107,602,339 G196D probably damaging Het
Hif1a T C 12: 73,939,557 S341P probably damaging Het
Hivep1 G T 13: 42,158,316 S1344I probably benign Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Ift81 A G 5: 122,594,616 L285S possibly damaging Het
Inpp4b T A 8: 82,122,624 N891K probably damaging Het
Irx6 C T 8: 92,678,353 T283M probably benign Het
Kdm5b A G 1: 134,631,351 K1538E probably benign Het
Kif13a A G 13: 46,929,599 V8A probably damaging Het
Krtap15 T A 16: 88,829,148 N34K probably damaging Het
Lama2 T G 10: 27,369,141 I215L probably damaging Het
Ldlrad3 C T 2: 102,069,983 R58H possibly damaging Het
Lvrn C T 18: 46,894,725 P869L probably damaging Het
Myo1d A G 11: 80,674,678 F411S probably damaging Het
Myo5b T A 18: 74,695,384 H702Q probably benign Het
Nat8f4 G T 6: 85,901,419 Q41K probably benign Het
Nckap5 C A 1: 126,027,028 E596* probably null Het
Nek10 T A 14: 14,846,594 probably null Het
Notch3 T C 17: 32,144,731 Y1145C probably damaging Het
Nr4a2 A T 2: 57,112,023 H76Q probably benign Het
Nup98 T C 7: 102,134,978 Q1049R probably damaging Het
Olfr1080 A T 2: 86,553,509 F205Y probably damaging Het
Olfr1298 A T 2: 111,645,776 S74T possibly damaging Het
Olfr172 T A 16: 58,760,619 R186* probably null Het
Pepd T C 7: 35,020,984 Y231H probably benign Het
Plagl1 G T 10: 13,127,557 A190S possibly damaging Het
Plat T A 8: 22,778,253 I345N probably damaging Het
Pnmt A G 11: 98,387,460 E120G probably damaging Het
Prkrip1 C A 5: 136,198,943 probably null Het
Pygm G A 19: 6,393,724 A572T probably damaging Het
Rbm4b T C 19: 4,757,372 F39L probably damaging Het
Rpe65 A G 3: 159,622,631 H388R probably benign Het
Scn4a G T 11: 106,320,088 A1701E possibly damaging Het
Sdk2 C A 11: 113,857,758 W616L probably damaging Het
Serpina3m T A 12: 104,391,470 S218T probably benign Het
Siglece C T 7: 43,659,873 R87H probably damaging Het
Sim1 C A 10: 50,909,902 L284M probably damaging Het
Smok3c G T 5: 138,065,582 E444* probably null Het
Snx4 T C 16: 33,294,730 V427A probably benign Het
Srp68 A T 11: 116,260,858 V304E probably damaging Het
Stag1 A T 9: 100,796,755 H243L possibly damaging Het
Stx6 T C 1: 155,173,991 V14A probably damaging Het
Sv2b T A 7: 75,136,421 Y417F probably benign Het
Tas2r103 A G 6: 133,036,198 Y302H probably benign Het
Thop1 T C 10: 81,080,194 S404P probably benign Het
Ube3c A G 5: 29,631,271 E630G possibly damaging Het
Usf3 T C 16: 44,217,355 S733P probably benign Het
Vmn1r195 A G 13: 22,279,019 T220A probably benign Het
Vmn1r201 A T 13: 22,474,712 H32L probably benign Het
Wnt2 A G 6: 18,023,240 C137R probably damaging Het
Ythdc2 T C 18: 44,847,804 S489P probably damaging Het
Zfp248 A G 6: 118,429,072 C418R probably damaging Het
Zfp946 T G 17: 22,455,521 F419V probably damaging Het
Zfp994 C T 17: 22,200,757 E404K probably damaging Het
Zfpm1 T C 8: 122,334,608 V304A possibly damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121247814 intron probably null
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121244060 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CAGTGTCAATCAATACCATGAAATG -3'
(R):5'- ACATATCAAAGAGTTGGCTTTTGGG -3'

Sequencing Primer
(F):5'- GCCATGCAATGAATCAATGCTG -3'
(R):5'- CAAAGAGTTGGCTTTTGGGGTTTATG -3'
Posted On2016-04-15