Mutagenetix > Incidental Mutation

Incidental Mutation 'R4924:Rpe65'

378846

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

042526-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R4924 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 159622631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 388 (H388R)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably benign
Transcript: ENSMUST00000029824
AA Change: H388R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: H388R

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196999
AA Change: H388R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: H388R

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,011,525	H625Y	probably damaging	Het
Adamts4	C	T	1: 171,259,074	R812W	probably damaging	Het
Ajuba	A	C	14: 54,571,599		probably null	Het
Aox2	T	A	1: 58,305,344	V532D	probably damaging	Het
Arpc1b	G	A	5: 145,126,815	S295N	probably benign	Het
Baiap2	A	G	11: 119,997,024	S335G	probably damaging	Het
BC051142	C	T	17: 34,459,977	P221L	probably damaging	Het
Brap	T	G	5: 121,665,255	N155K	probably damaging	Het
Btn1a1	A	G	13: 23,464,226		probably benign	Het
Ccl12	G	A	11: 82,102,649	V38I	probably benign	Het
Cemip	T	C	7: 83,952,938	Y881C	probably damaging	Het
Cep128	T	C	12: 91,022,400		silent	Het
Chd5	A	C	4: 152,366,429	D670A	possibly damaging	Het
Cmip	T	C	8: 117,257,255	Y52H	probably benign	Het
Dmtn	A	G	14: 70,617,959	I30T	probably benign	Het
Dscaml1	T	A	9: 45,745,189	M1609K	probably damaging	Het
Edar	C	A	10: 58,629,375	E55D	probably damaging	Het
Ehmt1	A	T	2: 24,839,722	I601N	probably damaging	Het
Fam120a	A	T	13: 48,902,096	N705K	probably benign	Het
Gm21718	G	T	14: 51,312,835		noncoding transcript	Het
Gnaz	A	G	10: 74,991,713	D99G	probably benign	Het
Helz	G	A	11: 107,602,339	G196D	probably damaging	Het
Hif1a	T	C	12: 73,939,557	S341P	probably damaging	Het
Hivep1	G	T	13: 42,158,316	S1344I	probably benign	Het
Hspa1l	T	A	17: 34,977,856	Y290*	probably null	Het
Ift81	A	G	5: 122,594,616	L285S	possibly damaging	Het
Inpp4b	T	A	8: 82,122,624	N891K	probably damaging	Het
Irx6	C	T	8: 92,678,353	T283M	probably benign	Het
Kdm5b	A	G	1: 134,631,351	K1538E	probably benign	Het
Kif13a	A	G	13: 46,929,599	V8A	probably damaging	Het
Krtap15	T	A	16: 88,829,148	N34K	probably damaging	Het
Lama2	T	G	10: 27,369,141	I215L	probably damaging	Het
Ldlrad3	C	T	2: 102,069,983	R58H	possibly damaging	Het
Lvrn	C	T	18: 46,894,725	P869L	probably damaging	Het
Myo1d	A	G	11: 80,674,678	F411S	probably damaging	Het
Myo5b	T	A	18: 74,695,384	H702Q	probably benign	Het
Nat8f4	G	T	6: 85,901,419	Q41K	probably benign	Het
Nckap5	C	A	1: 126,027,028	E596*	probably null	Het
Nek10	T	A	14: 14,846,594		probably null	Het
Notch3	T	C	17: 32,144,731	Y1145C	probably damaging	Het
Nr4a2	A	T	2: 57,112,023	H76Q	probably benign	Het
Nup98	T	C	7: 102,134,978	Q1049R	probably damaging	Het
Olfr1080	A	T	2: 86,553,509	F205Y	probably damaging	Het
Olfr1298	A	T	2: 111,645,776	S74T	possibly damaging	Het
Olfr172	T	A	16: 58,760,619	R186*	probably null	Het
Pepd	T	C	7: 35,020,984	Y231H	probably benign	Het
Plagl1	G	T	10: 13,127,557	A190S	possibly damaging	Het
Plat	T	A	8: 22,778,253	I345N	probably damaging	Het
Pnmt	A	G	11: 98,387,460	E120G	probably damaging	Het
Prkrip1	C	A	5: 136,198,943		probably null	Het
Pygm	G	A	19: 6,393,724	A572T	probably damaging	Het
Rbm4b	T	C	19: 4,757,372	F39L	probably damaging	Het
Scn4a	G	T	11: 106,320,088	A1701E	possibly damaging	Het
Sdk2	C	A	11: 113,857,758	W616L	probably damaging	Het
Serpina3m	T	A	12: 104,391,470	S218T	probably benign	Het
Siglece	C	T	7: 43,659,873	R87H	probably damaging	Het
Sim1	C	A	10: 50,909,902	L284M	probably damaging	Het
Smok3c	G	T	5: 138,065,582	E444*	probably null	Het
Snx4	T	C	16: 33,294,730	V427A	probably benign	Het
Srp68	A	T	11: 116,260,858	V304E	probably damaging	Het
Stag1	A	T	9: 100,796,755	H243L	possibly damaging	Het
Stx6	T	C	1: 155,173,991	V14A	probably damaging	Het
Sv2b	T	A	7: 75,136,421	Y417F	probably benign	Het
Tas2r103	A	G	6: 133,036,198	Y302H	probably benign	Het
Thop1	T	C	10: 81,080,194	S404P	probably benign	Het
Trp53bp1	G	T	2: 121,221,220	C988*	probably null	Het
Ube3c	A	G	5: 29,631,271	E630G	possibly damaging	Het
Usf3	T	C	16: 44,217,355	S733P	probably benign	Het
Vmn1r195	A	G	13: 22,279,019	T220A	probably benign	Het
Vmn1r201	A	T	13: 22,474,712	H32L	probably benign	Het
Wnt2	A	G	6: 18,023,240	C137R	probably damaging	Het
Ythdc2	T	C	18: 44,847,804	S489P	probably damaging	Het
Zfp248	A	G	6: 118,429,072	C418R	probably damaging	Het
Zfp946	T	G	17: 22,455,521	F419V	probably damaging	Het
Zfp994	C	T	17: 22,200,757	E404K	probably damaging	Het
Zfpm1	T	C	8: 122,334,608	V304A	possibly damaging	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACAGTAACCAGTCTCCTTGTCTG -3'
(R):5'- AGGTTTCCCTCCAAATTTCTGG -3'

Sequencing Primer
(F):5'- CCAGTCTCCTTGTCTGGTTGTTG -3'
(R):5'- GTTTCCCTCCAAATTTCTGGTAATTG -3'

Posted On

2016-04-15