Incidental Mutation 'R4924:Ift81'
ID378853
Institutional Source Beutler Lab
Gene Symbol Ift81
Ensembl Gene ENSMUSG00000029469
Gene Nameintraflagellar transport 81
SynonymsCDV-1R, Cdv1
MMRRC Submission 042526-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4924 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122550204-122614518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122594616 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 285 (L285S)
Ref Sequence ENSEMBL: ENSMUSP00000031426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031426]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031426
AA Change: L285S

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031426
Gene: ENSMUSG00000029469
AA Change: L285S

DomainStartEndE-ValueType
PDB:4LVP|A 5 128 2e-23 PDB
coiled coil region 167 258 N/A INTRINSIC
coiled coil region 308 383 N/A INTRINSIC
coiled coil region 503 591 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139590
AA Change: L129S
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with IFT74, forms a tubulin-binding module of intraflagellar transport complex B. This module is involved in transport of tubulin within the cilium, and the encoded protein is required for ciliogenesis. Mutations in this gene are a cause of short-rib polydactyly syndromes. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,011,525 H625Y probably damaging Het
Adamts4 C T 1: 171,259,074 R812W probably damaging Het
Ajuba A C 14: 54,571,599 probably null Het
Aox2 T A 1: 58,305,344 V532D probably damaging Het
Arpc1b G A 5: 145,126,815 S295N probably benign Het
Baiap2 A G 11: 119,997,024 S335G probably damaging Het
BC051142 C T 17: 34,459,977 P221L probably damaging Het
Brap T G 5: 121,665,255 N155K probably damaging Het
Btn1a1 A G 13: 23,464,226 probably benign Het
Ccl12 G A 11: 82,102,649 V38I probably benign Het
Cemip T C 7: 83,952,938 Y881C probably damaging Het
Cep128 T C 12: 91,022,400 silent Het
Chd5 A C 4: 152,366,429 D670A possibly damaging Het
Cmip T C 8: 117,257,255 Y52H probably benign Het
Dmtn A G 14: 70,617,959 I30T probably benign Het
Dscaml1 T A 9: 45,745,189 M1609K probably damaging Het
Edar C A 10: 58,629,375 E55D probably damaging Het
Ehmt1 A T 2: 24,839,722 I601N probably damaging Het
Fam120a A T 13: 48,902,096 N705K probably benign Het
Gm21718 G T 14: 51,312,835 noncoding transcript Het
Gnaz A G 10: 74,991,713 D99G probably benign Het
Helz G A 11: 107,602,339 G196D probably damaging Het
Hif1a T C 12: 73,939,557 S341P probably damaging Het
Hivep1 G T 13: 42,158,316 S1344I probably benign Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Inpp4b T A 8: 82,122,624 N891K probably damaging Het
Irx6 C T 8: 92,678,353 T283M probably benign Het
Kdm5b A G 1: 134,631,351 K1538E probably benign Het
Kif13a A G 13: 46,929,599 V8A probably damaging Het
Krtap15 T A 16: 88,829,148 N34K probably damaging Het
Lama2 T G 10: 27,369,141 I215L probably damaging Het
Ldlrad3 C T 2: 102,069,983 R58H possibly damaging Het
Lvrn C T 18: 46,894,725 P869L probably damaging Het
Myo1d A G 11: 80,674,678 F411S probably damaging Het
Myo5b T A 18: 74,695,384 H702Q probably benign Het
Nat8f4 G T 6: 85,901,419 Q41K probably benign Het
Nckap5 C A 1: 126,027,028 E596* probably null Het
Nek10 T A 14: 14,846,594 probably null Het
Notch3 T C 17: 32,144,731 Y1145C probably damaging Het
Nr4a2 A T 2: 57,112,023 H76Q probably benign Het
Nup98 T C 7: 102,134,978 Q1049R probably damaging Het
Olfr1080 A T 2: 86,553,509 F205Y probably damaging Het
Olfr1298 A T 2: 111,645,776 S74T possibly damaging Het
Olfr172 T A 16: 58,760,619 R186* probably null Het
Pepd T C 7: 35,020,984 Y231H probably benign Het
Plagl1 G T 10: 13,127,557 A190S possibly damaging Het
Plat T A 8: 22,778,253 I345N probably damaging Het
Pnmt A G 11: 98,387,460 E120G probably damaging Het
Prkrip1 C A 5: 136,198,943 probably null Het
Pygm G A 19: 6,393,724 A572T probably damaging Het
Rbm4b T C 19: 4,757,372 F39L probably damaging Het
Rpe65 A G 3: 159,622,631 H388R probably benign Het
Scn4a G T 11: 106,320,088 A1701E possibly damaging Het
Sdk2 C A 11: 113,857,758 W616L probably damaging Het
Serpina3m T A 12: 104,391,470 S218T probably benign Het
Siglece C T 7: 43,659,873 R87H probably damaging Het
Sim1 C A 10: 50,909,902 L284M probably damaging Het
Smok3c G T 5: 138,065,582 E444* probably null Het
Snx4 T C 16: 33,294,730 V427A probably benign Het
Srp68 A T 11: 116,260,858 V304E probably damaging Het
Stag1 A T 9: 100,796,755 H243L possibly damaging Het
Stx6 T C 1: 155,173,991 V14A probably damaging Het
Sv2b T A 7: 75,136,421 Y417F probably benign Het
Tas2r103 A G 6: 133,036,198 Y302H probably benign Het
Thop1 T C 10: 81,080,194 S404P probably benign Het
Trp53bp1 G T 2: 121,221,220 C988* probably null Het
Ube3c A G 5: 29,631,271 E630G possibly damaging Het
Usf3 T C 16: 44,217,355 S733P probably benign Het
Vmn1r195 A G 13: 22,279,019 T220A probably benign Het
Vmn1r201 A T 13: 22,474,712 H32L probably benign Het
Wnt2 A G 6: 18,023,240 C137R probably damaging Het
Ythdc2 T C 18: 44,847,804 S489P probably damaging Het
Zfp248 A G 6: 118,429,072 C418R probably damaging Het
Zfp946 T G 17: 22,455,521 F419V probably damaging Het
Zfp994 C T 17: 22,200,757 E404K probably damaging Het
Zfpm1 T C 8: 122,334,608 V304A possibly damaging Het
Other mutations in Ift81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Ift81 APN 5 122610968 missense probably damaging 1.00
IGL01867:Ift81 APN 5 122602676 splice site probably benign
IGL01927:Ift81 APN 5 122593129 missense probably benign 0.25
IGL02954:Ift81 APN 5 122610185 splice site probably benign
IGL03003:Ift81 APN 5 122594662 missense probably benign 0.01
R1179:Ift81 UTSW 5 122602710 missense probably benign 0.22
R1394:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1395:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1962:Ift81 UTSW 5 122560709 missense probably benign 0.01
R2084:Ift81 UTSW 5 122567347 missense probably benign 0.00
R4019:Ift81 UTSW 5 122593129 missense probably benign 0.25
R4769:Ift81 UTSW 5 122594593 missense probably benign 0.16
R4849:Ift81 UTSW 5 122591219 missense probably damaging 1.00
R4905:Ift81 UTSW 5 122591079 critical splice donor site probably null
R5110:Ift81 UTSW 5 122551058 missense probably benign 0.02
R5299:Ift81 UTSW 5 122607056 missense probably damaging 0.99
R5387:Ift81 UTSW 5 122555535 missense probably damaging 1.00
R6190:Ift81 UTSW 5 122551100 missense probably benign 0.00
R6241:Ift81 UTSW 5 122602351 missense probably benign 0.38
R6404:Ift81 UTSW 5 122611006 missense probably damaging 1.00
R6647:Ift81 UTSW 5 122610166 nonsense probably null
R7155:Ift81 UTSW 5 122568999 missense probably damaging 0.99
R7170:Ift81 UTSW 5 122555533 nonsense probably null
R7699:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7700:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7709:Ift81 UTSW 5 122609331 missense probably damaging 1.00
R7756:Ift81 UTSW 5 122551025 missense probably damaging 1.00
R7758:Ift81 UTSW 5 122551025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCAACCCTTAGCCCAGG -3'
(R):5'- TGTATAGATGCTGCACAGAGAGC -3'

Sequencing Primer
(F):5'- CAGGCTAGCTCTAGAGTCACAAG -3'
(R):5'- TGCTGCACAGAGAGCTTTAAC -3'
Posted On2016-04-15