Incidental Mutation 'R4924:Arpc1b'
ID378856
Institutional Source Beutler Lab
Gene Symbol Arpc1b
Ensembl Gene ENSMUSG00000029622
Gene Nameactin related protein 2/3 complex, subunit 1B
SynonymsSOP2Hs, L72, p41-ARC
MMRRC Submission 042526-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4924 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145114215-145130705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145126815 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 295 (S295N)
Ref Sequence ENSEMBL: ENSMUSP00000143438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031627] [ENSMUST00000085679] [ENSMUST00000136074] [ENSMUST00000141602] [ENSMUST00000196111]
Predicted Effect probably benign
Transcript: ENSMUST00000031627
SMART Domains Protein: ENSMUSP00000031627
Gene: ENSMUSG00000029623

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:PP28 84 163 3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085679
AA Change: S291N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000082822
Gene: ENSMUSG00000029622
AA Change: S291N

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 233 271 9e-18 BLAST
WD40 317 358 3.55e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129033
Predicted Effect probably benign
Transcript: ENSMUST00000136074
SMART Domains Protein: ENSMUSP00000115022
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Pfam:WD40 3 29 2.5e-3 PFAM
WD40 77 121 1.79e-1 SMART
WD40 142 181 7.7e-1 SMART
Blast:WD40 184 222 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138900
Predicted Effect unknown
Transcript: ENSMUST00000138922
AA Change: S19N
SMART Domains Protein: ENSMUSP00000115515
Gene: ENSMUSG00000029622
AA Change: S19N

DomainStartEndE-ValueType
PDB:2P9U|C 2 93 4e-43 PDB
SCOP:d1k8kc_ 35 93 2e-11 SMART
Blast:WD40 50 87 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141602
SMART Domains Protein: ENSMUSP00000122340
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-15 BLAST
PDB:2P9U|C 1 56 2e-33 PDB
SCOP:d1k8kc_ 9 56 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144375
Predicted Effect probably benign
Transcript: ENSMUST00000196111
AA Change: S295N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000143438
Gene: ENSMUSG00000029622
AA Change: S295N

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 237 275 2e-16 BLAST
WD40 321 362 3.55e1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,011,525 H625Y probably damaging Het
Adamts4 C T 1: 171,259,074 R812W probably damaging Het
Ajuba A C 14: 54,571,599 probably null Het
Aox2 T A 1: 58,305,344 V532D probably damaging Het
Baiap2 A G 11: 119,997,024 S335G probably damaging Het
BC051142 C T 17: 34,459,977 P221L probably damaging Het
Brap T G 5: 121,665,255 N155K probably damaging Het
Btn1a1 A G 13: 23,464,226 probably benign Het
Ccl12 G A 11: 82,102,649 V38I probably benign Het
Cemip T C 7: 83,952,938 Y881C probably damaging Het
Cep128 T C 12: 91,022,400 silent Het
Chd5 A C 4: 152,366,429 D670A possibly damaging Het
Cmip T C 8: 117,257,255 Y52H probably benign Het
Dmtn A G 14: 70,617,959 I30T probably benign Het
Dscaml1 T A 9: 45,745,189 M1609K probably damaging Het
Edar C A 10: 58,629,375 E55D probably damaging Het
Ehmt1 A T 2: 24,839,722 I601N probably damaging Het
Fam120a A T 13: 48,902,096 N705K probably benign Het
Gm21718 G T 14: 51,312,835 noncoding transcript Het
Gnaz A G 10: 74,991,713 D99G probably benign Het
Helz G A 11: 107,602,339 G196D probably damaging Het
Hif1a T C 12: 73,939,557 S341P probably damaging Het
Hivep1 G T 13: 42,158,316 S1344I probably benign Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Ift81 A G 5: 122,594,616 L285S possibly damaging Het
Inpp4b T A 8: 82,122,624 N891K probably damaging Het
Irx6 C T 8: 92,678,353 T283M probably benign Het
Kdm5b A G 1: 134,631,351 K1538E probably benign Het
Kif13a A G 13: 46,929,599 V8A probably damaging Het
Krtap15 T A 16: 88,829,148 N34K probably damaging Het
Lama2 T G 10: 27,369,141 I215L probably damaging Het
Ldlrad3 C T 2: 102,069,983 R58H possibly damaging Het
Lvrn C T 18: 46,894,725 P869L probably damaging Het
Myo1d A G 11: 80,674,678 F411S probably damaging Het
Myo5b T A 18: 74,695,384 H702Q probably benign Het
Nat8f4 G T 6: 85,901,419 Q41K probably benign Het
Nckap5 C A 1: 126,027,028 E596* probably null Het
Nek10 T A 14: 14,846,594 probably null Het
Notch3 T C 17: 32,144,731 Y1145C probably damaging Het
Nr4a2 A T 2: 57,112,023 H76Q probably benign Het
Nup98 T C 7: 102,134,978 Q1049R probably damaging Het
Olfr1080 A T 2: 86,553,509 F205Y probably damaging Het
Olfr1298 A T 2: 111,645,776 S74T possibly damaging Het
Olfr172 T A 16: 58,760,619 R186* probably null Het
Pepd T C 7: 35,020,984 Y231H probably benign Het
Plagl1 G T 10: 13,127,557 A190S possibly damaging Het
Plat T A 8: 22,778,253 I345N probably damaging Het
Pnmt A G 11: 98,387,460 E120G probably damaging Het
Prkrip1 C A 5: 136,198,943 probably null Het
Pygm G A 19: 6,393,724 A572T probably damaging Het
Rbm4b T C 19: 4,757,372 F39L probably damaging Het
Rpe65 A G 3: 159,622,631 H388R probably benign Het
Scn4a G T 11: 106,320,088 A1701E possibly damaging Het
Sdk2 C A 11: 113,857,758 W616L probably damaging Het
Serpina3m T A 12: 104,391,470 S218T probably benign Het
Siglece C T 7: 43,659,873 R87H probably damaging Het
Sim1 C A 10: 50,909,902 L284M probably damaging Het
Smok3c G T 5: 138,065,582 E444* probably null Het
Snx4 T C 16: 33,294,730 V427A probably benign Het
Srp68 A T 11: 116,260,858 V304E probably damaging Het
Stag1 A T 9: 100,796,755 H243L possibly damaging Het
Stx6 T C 1: 155,173,991 V14A probably damaging Het
Sv2b T A 7: 75,136,421 Y417F probably benign Het
Tas2r103 A G 6: 133,036,198 Y302H probably benign Het
Thop1 T C 10: 81,080,194 S404P probably benign Het
Trp53bp1 G T 2: 121,221,220 C988* probably null Het
Ube3c A G 5: 29,631,271 E630G possibly damaging Het
Usf3 T C 16: 44,217,355 S733P probably benign Het
Vmn1r195 A G 13: 22,279,019 T220A probably benign Het
Vmn1r201 A T 13: 22,474,712 H32L probably benign Het
Wnt2 A G 6: 18,023,240 C137R probably damaging Het
Ythdc2 T C 18: 44,847,804 S489P probably damaging Het
Zfp248 A G 6: 118,429,072 C418R probably damaging Het
Zfp946 T G 17: 22,455,521 F419V probably damaging Het
Zfp994 C T 17: 22,200,757 E404K probably damaging Het
Zfpm1 T C 8: 122,334,608 V304A possibly damaging Het
Other mutations in Arpc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Arpc1b APN 5 145127869 utr 3 prime probably benign
IGL01625:Arpc1b APN 5 145121745 splice site probably null
IGL01859:Arpc1b APN 5 145123730 missense probably damaging 0.98
illusory UTSW 5 145122567 missense probably damaging 1.00
FR4304:Arpc1b UTSW 5 145126791 frame shift probably null
FR4340:Arpc1b UTSW 5 145126792 frame shift probably null
FR4737:Arpc1b UTSW 5 145126787 frame shift probably null
R0110:Arpc1b UTSW 5 145127715 missense probably damaging 1.00
R0245:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0469:Arpc1b UTSW 5 145127715 missense probably damaging 1.00
R0652:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0827:Arpc1b UTSW 5 145125756 missense probably benign 0.34
R1117:Arpc1b UTSW 5 145125754 missense possibly damaging 0.95
R1453:Arpc1b UTSW 5 145125745 missense probably damaging 1.00
R1895:Arpc1b UTSW 5 145122633 missense probably null 0.99
R1946:Arpc1b UTSW 5 145122633 missense probably null 0.99
R2050:Arpc1b UTSW 5 145125919 missense probably damaging 1.00
R2112:Arpc1b UTSW 5 145123769 missense probably damaging 0.99
R6534:Arpc1b UTSW 5 145122567 missense probably damaging 1.00
R6883:Arpc1b UTSW 5 145126929 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CTGCCAGATGCCTCATTACCATG -3'
(R):5'- TTCCTTCTGTTGGAGCGCAG -3'

Sequencing Primer
(F):5'- AGATGCCTCATTACCATGTTTCAC -3'
(R):5'- AGCCTGGAAGTCTGCCTG -3'
Posted On2016-04-15