Incidental Mutation 'R4924:Zfp248'
ID378859
Institutional Source Beutler Lab
Gene Symbol Zfp248
Ensembl Gene ENSMUSG00000030145
Gene Namezinc finger protein 248
SynonymsE130106N01Rik, 2810037F07Rik
MMRRC Submission 042526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4924 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118427319-118455528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118429072 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 418 (C418R)
Ref Sequence ENSEMBL: ENSMUSP00000124539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069292] [ENSMUST00000159403] [ENSMUST00000161519]
Predicted Effect probably damaging
Transcript: ENSMUST00000069292
AA Change: C519R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068807
Gene: ENSMUSG00000030145
AA Change: C519R

DomainStartEndE-ValueType
KRAB 8 68 2.4e-35 SMART
internal_repeat_1 209 375 2.52e-18 PROSPERO
ZnF_C2H2 377 399 3.89e-3 SMART
ZnF_C2H2 405 427 3.95e-4 SMART
ZnF_C2H2 433 455 4.24e-4 SMART
ZnF_C2H2 461 483 8.94e-3 SMART
ZnF_C2H2 489 511 8.47e-4 SMART
ZnF_C2H2 517 539 8.02e-5 SMART
ZnF_C2H2 545 567 6.52e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159403
Predicted Effect probably damaging
Transcript: ENSMUST00000161519
AA Change: C418R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124539
Gene: ENSMUSG00000030145
AA Change: C418R

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 165 188 3.3e-2 PFAM
ZnF_C2H2 276 298 3.89e-3 SMART
ZnF_C2H2 304 326 3.95e-4 SMART
ZnF_C2H2 332 354 4.24e-4 SMART
ZnF_C2H2 360 382 8.94e-3 SMART
ZnF_C2H2 388 410 8.47e-4 SMART
ZnF_C2H2 416 438 8.02e-5 SMART
ZnF_C2H2 444 466 6.52e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175338
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,011,525 H625Y probably damaging Het
Adamts4 C T 1: 171,259,074 R812W probably damaging Het
Ajuba A C 14: 54,571,599 probably null Het
Aox2 T A 1: 58,305,344 V532D probably damaging Het
Arpc1b G A 5: 145,126,815 S295N probably benign Het
Baiap2 A G 11: 119,997,024 S335G probably damaging Het
BC051142 C T 17: 34,459,977 P221L probably damaging Het
Brap T G 5: 121,665,255 N155K probably damaging Het
Btn1a1 A G 13: 23,464,226 probably benign Het
Ccl12 G A 11: 82,102,649 V38I probably benign Het
Cemip T C 7: 83,952,938 Y881C probably damaging Het
Cep128 T C 12: 91,022,400 silent Het
Chd5 A C 4: 152,366,429 D670A possibly damaging Het
Cmip T C 8: 117,257,255 Y52H probably benign Het
Dmtn A G 14: 70,617,959 I30T probably benign Het
Dscaml1 T A 9: 45,745,189 M1609K probably damaging Het
Edar C A 10: 58,629,375 E55D probably damaging Het
Ehmt1 A T 2: 24,839,722 I601N probably damaging Het
Fam120a A T 13: 48,902,096 N705K probably benign Het
Gm21718 G T 14: 51,312,835 noncoding transcript Het
Gnaz A G 10: 74,991,713 D99G probably benign Het
Helz G A 11: 107,602,339 G196D probably damaging Het
Hif1a T C 12: 73,939,557 S341P probably damaging Het
Hivep1 G T 13: 42,158,316 S1344I probably benign Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Ift81 A G 5: 122,594,616 L285S possibly damaging Het
Inpp4b T A 8: 82,122,624 N891K probably damaging Het
Irx6 C T 8: 92,678,353 T283M probably benign Het
Kdm5b A G 1: 134,631,351 K1538E probably benign Het
Kif13a A G 13: 46,929,599 V8A probably damaging Het
Krtap15 T A 16: 88,829,148 N34K probably damaging Het
Lama2 T G 10: 27,369,141 I215L probably damaging Het
Ldlrad3 C T 2: 102,069,983 R58H possibly damaging Het
Lvrn C T 18: 46,894,725 P869L probably damaging Het
Myo1d A G 11: 80,674,678 F411S probably damaging Het
Myo5b T A 18: 74,695,384 H702Q probably benign Het
Nat8f4 G T 6: 85,901,419 Q41K probably benign Het
Nckap5 C A 1: 126,027,028 E596* probably null Het
Nek10 T A 14: 14,846,594 probably null Het
Notch3 T C 17: 32,144,731 Y1145C probably damaging Het
Nr4a2 A T 2: 57,112,023 H76Q probably benign Het
Nup98 T C 7: 102,134,978 Q1049R probably damaging Het
Olfr1080 A T 2: 86,553,509 F205Y probably damaging Het
Olfr1298 A T 2: 111,645,776 S74T possibly damaging Het
Olfr172 T A 16: 58,760,619 R186* probably null Het
Pepd T C 7: 35,020,984 Y231H probably benign Het
Plagl1 G T 10: 13,127,557 A190S possibly damaging Het
Plat T A 8: 22,778,253 I345N probably damaging Het
Pnmt A G 11: 98,387,460 E120G probably damaging Het
Prkrip1 C A 5: 136,198,943 probably null Het
Pygm G A 19: 6,393,724 A572T probably damaging Het
Rbm4b T C 19: 4,757,372 F39L probably damaging Het
Rpe65 A G 3: 159,622,631 H388R probably benign Het
Scn4a G T 11: 106,320,088 A1701E possibly damaging Het
Sdk2 C A 11: 113,857,758 W616L probably damaging Het
Serpina3m T A 12: 104,391,470 S218T probably benign Het
Siglece C T 7: 43,659,873 R87H probably damaging Het
Sim1 C A 10: 50,909,902 L284M probably damaging Het
Smok3c G T 5: 138,065,582 E444* probably null Het
Snx4 T C 16: 33,294,730 V427A probably benign Het
Srp68 A T 11: 116,260,858 V304E probably damaging Het
Stag1 A T 9: 100,796,755 H243L possibly damaging Het
Stx6 T C 1: 155,173,991 V14A probably damaging Het
Sv2b T A 7: 75,136,421 Y417F probably benign Het
Tas2r103 A G 6: 133,036,198 Y302H probably benign Het
Thop1 T C 10: 81,080,194 S404P probably benign Het
Trp53bp1 G T 2: 121,221,220 C988* probably null Het
Ube3c A G 5: 29,631,271 E630G possibly damaging Het
Usf3 T C 16: 44,217,355 S733P probably benign Het
Vmn1r195 A G 13: 22,279,019 T220A probably benign Het
Vmn1r201 A T 13: 22,474,712 H32L probably benign Het
Wnt2 A G 6: 18,023,240 C137R probably damaging Het
Ythdc2 T C 18: 44,847,804 S489P probably damaging Het
Zfp946 T G 17: 22,455,521 F419V probably damaging Het
Zfp994 C T 17: 22,200,757 E404K probably damaging Het
Zfpm1 T C 8: 122,334,608 V304A possibly damaging Het
Other mutations in Zfp248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Zfp248 APN 6 118429732 missense probably damaging 1.00
IGL02268:Zfp248 APN 6 118453840 intron probably benign
R1374:Zfp248 UTSW 6 118433373 missense probably damaging 1.00
R1678:Zfp248 UTSW 6 118429804 missense probably benign 0.02
R1794:Zfp248 UTSW 6 118429303 missense probably damaging 1.00
R1834:Zfp248 UTSW 6 118428970 missense probably damaging 0.98
R3900:Zfp248 UTSW 6 118429566 missense probably damaging 1.00
R3948:Zfp248 UTSW 6 118430194 frame shift probably null
R4661:Zfp248 UTSW 6 118433307 missense possibly damaging 0.84
R4810:Zfp248 UTSW 6 118429846 missense possibly damaging 0.68
R4926:Zfp248 UTSW 6 118429826 missense possibly damaging 0.74
R7326:Zfp248 UTSW 6 118430209 missense probably damaging 1.00
R7357:Zfp248 UTSW 6 118429657 missense probably damaging 1.00
R7910:Zfp248 UTSW 6 118430142 missense possibly damaging 0.93
R7991:Zfp248 UTSW 6 118430142 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTTGACAGGCATGCGAAAG -3'
(R):5'- GCCAGCTCTCTTCAAACATCAG -3'

Sequencing Primer
(F):5'- GCTAAACACTCAGGATGCTAAAAG -3'
(R):5'- GACGTTCTGTGTCAAGTCAAACC -3'
Posted On2016-04-15