Incidental Mutation 'R4924:Cemip'
ID378864
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
MMRRC Submission 042526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4924 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83952938 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 881 (Y881C)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably damaging
Transcript: ENSMUST00000064174
AA Change: Y881C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: Y881C

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150495
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,011,525 H625Y probably damaging Het
Adamts4 C T 1: 171,259,074 R812W probably damaging Het
Ajuba A C 14: 54,571,599 probably null Het
Aox2 T A 1: 58,305,344 V532D probably damaging Het
Arpc1b G A 5: 145,126,815 S295N probably benign Het
Baiap2 A G 11: 119,997,024 S335G probably damaging Het
BC051142 C T 17: 34,459,977 P221L probably damaging Het
Brap T G 5: 121,665,255 N155K probably damaging Het
Btn1a1 A G 13: 23,464,226 probably benign Het
Ccl12 G A 11: 82,102,649 V38I probably benign Het
Cep128 T C 12: 91,022,400 silent Het
Chd5 A C 4: 152,366,429 D670A possibly damaging Het
Cmip T C 8: 117,257,255 Y52H probably benign Het
Dmtn A G 14: 70,617,959 I30T probably benign Het
Dscaml1 T A 9: 45,745,189 M1609K probably damaging Het
Edar C A 10: 58,629,375 E55D probably damaging Het
Ehmt1 A T 2: 24,839,722 I601N probably damaging Het
Fam120a A T 13: 48,902,096 N705K probably benign Het
Gm21718 G T 14: 51,312,835 noncoding transcript Het
Gnaz A G 10: 74,991,713 D99G probably benign Het
Helz G A 11: 107,602,339 G196D probably damaging Het
Hif1a T C 12: 73,939,557 S341P probably damaging Het
Hivep1 G T 13: 42,158,316 S1344I probably benign Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Ift81 A G 5: 122,594,616 L285S possibly damaging Het
Inpp4b T A 8: 82,122,624 N891K probably damaging Het
Irx6 C T 8: 92,678,353 T283M probably benign Het
Kdm5b A G 1: 134,631,351 K1538E probably benign Het
Kif13a A G 13: 46,929,599 V8A probably damaging Het
Krtap15 T A 16: 88,829,148 N34K probably damaging Het
Lama2 T G 10: 27,369,141 I215L probably damaging Het
Ldlrad3 C T 2: 102,069,983 R58H possibly damaging Het
Lvrn C T 18: 46,894,725 P869L probably damaging Het
Myo1d A G 11: 80,674,678 F411S probably damaging Het
Myo5b T A 18: 74,695,384 H702Q probably benign Het
Nat8f4 G T 6: 85,901,419 Q41K probably benign Het
Nckap5 C A 1: 126,027,028 E596* probably null Het
Nek10 T A 14: 14,846,594 probably null Het
Notch3 T C 17: 32,144,731 Y1145C probably damaging Het
Nr4a2 A T 2: 57,112,023 H76Q probably benign Het
Nup98 T C 7: 102,134,978 Q1049R probably damaging Het
Olfr1080 A T 2: 86,553,509 F205Y probably damaging Het
Olfr1298 A T 2: 111,645,776 S74T possibly damaging Het
Olfr172 T A 16: 58,760,619 R186* probably null Het
Pepd T C 7: 35,020,984 Y231H probably benign Het
Plagl1 G T 10: 13,127,557 A190S possibly damaging Het
Plat T A 8: 22,778,253 I345N probably damaging Het
Pnmt A G 11: 98,387,460 E120G probably damaging Het
Prkrip1 C A 5: 136,198,943 probably null Het
Pygm G A 19: 6,393,724 A572T probably damaging Het
Rbm4b T C 19: 4,757,372 F39L probably damaging Het
Rpe65 A G 3: 159,622,631 H388R probably benign Het
Scn4a G T 11: 106,320,088 A1701E possibly damaging Het
Sdk2 C A 11: 113,857,758 W616L probably damaging Het
Serpina3m T A 12: 104,391,470 S218T probably benign Het
Siglece C T 7: 43,659,873 R87H probably damaging Het
Sim1 C A 10: 50,909,902 L284M probably damaging Het
Smok3c G T 5: 138,065,582 E444* probably null Het
Snx4 T C 16: 33,294,730 V427A probably benign Het
Srp68 A T 11: 116,260,858 V304E probably damaging Het
Stag1 A T 9: 100,796,755 H243L possibly damaging Het
Stx6 T C 1: 155,173,991 V14A probably damaging Het
Sv2b T A 7: 75,136,421 Y417F probably benign Het
Tas2r103 A G 6: 133,036,198 Y302H probably benign Het
Thop1 T C 10: 81,080,194 S404P probably benign Het
Trp53bp1 G T 2: 121,221,220 C988* probably null Het
Ube3c A G 5: 29,631,271 E630G possibly damaging Het
Usf3 T C 16: 44,217,355 S733P probably benign Het
Vmn1r195 A G 13: 22,279,019 T220A probably benign Het
Vmn1r201 A T 13: 22,474,712 H32L probably benign Het
Wnt2 A G 6: 18,023,240 C137R probably damaging Het
Ythdc2 T C 18: 44,847,804 S489P probably damaging Het
Zfp248 A G 6: 118,429,072 C418R probably damaging Het
Zfp946 T G 17: 22,455,521 F419V probably damaging Het
Zfp994 C T 17: 22,200,757 E404K probably damaging Het
Zfpm1 T C 8: 122,334,608 V304A possibly damaging Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
PIT4618001:Cemip UTSW 7 83943939 missense probably benign 0.07
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
R7236:Cemip UTSW 7 83948804 splice site probably null
R7410:Cemip UTSW 7 83952834 missense probably damaging 1.00
R7483:Cemip UTSW 7 83998576 missense probably damaging 0.99
R7734:Cemip UTSW 7 83957664 nonsense probably null
R8005:Cemip UTSW 7 84003408 start gained probably benign
RF008:Cemip UTSW 7 83961635 missense probably damaging 0.99
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Z1177:Cemip UTSW 7 83947296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCACTTGAAGCCTGGC -3'
(R):5'- GCCCATAAATGCCTTCCCAGTG -3'

Sequencing Primer
(F):5'- ACTTGAAGCCTGGCTGTGC -3'
(R):5'- TGCCTTCCCAGTGAATTAATTAAC -3'
Posted On2016-04-15