Mutagenetix > Incidental Mutations

Incidental Mutation 'R4924:Dscaml1'

378872

Institutional Source

Beutler Lab

Gene Symbol

Dscaml1

Ensembl Gene

ENSMUSG00000032087

Gene Name

DS cell adhesion molecule like 1

Synonyms

4921507G06Rik, 4930435C18Rik

MMRRC Submission

042526-MU

Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene?

Possibly essential (E-score: 0.635) question?

Stock #

R4924 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

45426628-45753712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 45745189 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1609 (M1609K)

Ref Sequence

ENSEMBL: ENSMUSP00000034592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034592]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034592
AA Change: M1609K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: M1609K

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	28	55	N/A	INTRINSIC
IG_like	96	168	1.22e0	SMART
IG	189	277	1.15e-3	SMART
IGc2	296	359	2.54e-14	SMART
IGc2	385	451	8.12e-13	SMART
IGc2	478	550	9.55e-10	SMART
IGc2	575	640	9.78e-7	SMART
IGc2	666	734	5.93e-6	SMART
IGc2	760	832	6.75e-10	SMART
IG	853	943	1e-3	SMART
FN3	945	1029	6.64e-7	SMART
FN3	1045	1133	9.46e-12	SMART
FN3	1148	1234	3.2e-9	SMART
FN3	1249	1332	3.48e-10	SMART
IGc2	1363	1428	1.49e-11	SMART
FN3	1442	1522	3.42e-9	SMART
FN3	1537	1618	2.14e-1	SMART
low complexity region	1671	1683	N/A	INTRINSIC
low complexity region	2018	2026	N/A	INTRINSIC
low complexity region	2035	2069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215027

Predicted Effect

probably benign
Transcript: ENSMUST00000216685

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,011,525	H625Y	probably damaging	Het
Adamts4	C	T	1: 171,259,074	R812W	probably damaging	Het
Ajuba	A	C	14: 54,571,599		probably null	Het
Aox2	T	A	1: 58,305,344	V532D	probably damaging	Het
Arpc1b	G	A	5: 145,126,815	S295N	probably benign	Het
Baiap2	A	G	11: 119,997,024	S335G	probably damaging	Het
BC051142	C	T	17: 34,459,977	P221L	probably damaging	Het
Brap	T	G	5: 121,665,255	N155K	probably damaging	Het
Btn1a1	A	G	13: 23,464,226		probably benign	Het
Ccl12	G	A	11: 82,102,649	V38I	probably benign	Het
Cemip	T	C	7: 83,952,938	Y881C	probably damaging	Het
Cep128	T	C	12: 91,022,400		silent	Het
Chd5	A	C	4: 152,366,429	D670A	possibly damaging	Het
Cmip	T	C	8: 117,257,255	Y52H	probably benign	Het
Dmtn	A	G	14: 70,617,959	I30T	probably benign	Het
Edar	C	A	10: 58,629,375	E55D	probably damaging	Het
Ehmt1	A	T	2: 24,839,722	I601N	probably damaging	Het
Fam120a	A	T	13: 48,902,096	N705K	probably benign	Het
Gm21718	G	T	14: 51,312,835		noncoding transcript	Het
Gnaz	A	G	10: 74,991,713	D99G	probably benign	Het
Helz	G	A	11: 107,602,339	G196D	probably damaging	Het
Hif1a	T	C	12: 73,939,557	S341P	probably damaging	Het
Hivep1	G	T	13: 42,158,316	S1344I	probably benign	Het
Hspa1l	T	A	17: 34,977,856	Y290*	probably null	Het
Ift81	A	G	5: 122,594,616	L285S	possibly damaging	Het
Inpp4b	T	A	8: 82,122,624	N891K	probably damaging	Het
Irx6	C	T	8: 92,678,353	T283M	probably benign	Het
Kdm5b	A	G	1: 134,631,351	K1538E	probably benign	Het
Kif13a	A	G	13: 46,929,599	V8A	probably damaging	Het
Krtap15	T	A	16: 88,829,148	N34K	probably damaging	Het
Lama2	T	G	10: 27,369,141	I215L	probably damaging	Het
Ldlrad3	C	T	2: 102,069,983	R58H	possibly damaging	Het
Lvrn	C	T	18: 46,894,725	P869L	probably damaging	Het
Myo1d	A	G	11: 80,674,678	F411S	probably damaging	Het
Myo5b	T	A	18: 74,695,384	H702Q	probably benign	Het
Nat8f4	G	T	6: 85,901,419	Q41K	probably benign	Het
Nckap5	C	A	1: 126,027,028	E596*	probably null	Het
Nek10	T	A	14: 14,846,594		probably null	Het
Notch3	T	C	17: 32,144,731	Y1145C	probably damaging	Het
Nr4a2	A	T	2: 57,112,023	H76Q	probably benign	Het
Nup98	T	C	7: 102,134,978	Q1049R	probably damaging	Het
Olfr1080	A	T	2: 86,553,509	F205Y	probably damaging	Het
Olfr1298	A	T	2: 111,645,776	S74T	possibly damaging	Het
Olfr172	T	A	16: 58,760,619	R186*	probably null	Het
Pepd	T	C	7: 35,020,984	Y231H	probably benign	Het
Plagl1	G	T	10: 13,127,557	A190S	possibly damaging	Het
Plat	T	A	8: 22,778,253	I345N	probably damaging	Het
Pnmt	A	G	11: 98,387,460	E120G	probably damaging	Het
Prkrip1	C	A	5: 136,198,943		probably null	Het
Pygm	G	A	19: 6,393,724	A572T	probably damaging	Het
Rbm4b	T	C	19: 4,757,372	F39L	probably damaging	Het
Rpe65	A	G	3: 159,622,631	H388R	probably benign	Het
Scn4a	G	T	11: 106,320,088	A1701E	possibly damaging	Het
Sdk2	C	A	11: 113,857,758	W616L	probably damaging	Het
Serpina3m	T	A	12: 104,391,470	S218T	probably benign	Het
Siglece	C	T	7: 43,659,873	R87H	probably damaging	Het
Sim1	C	A	10: 50,909,902	L284M	probably damaging	Het
Smok3c	G	T	5: 138,065,582	E444*	probably null	Het
Snx4	T	C	16: 33,294,730	V427A	probably benign	Het
Srp68	A	T	11: 116,260,858	V304E	probably damaging	Het
Stag1	A	T	9: 100,796,755	H243L	possibly damaging	Het
Stx6	T	C	1: 155,173,991	V14A	probably damaging	Het
Sv2b	T	A	7: 75,136,421	Y417F	probably benign	Het
Tas2r103	A	G	6: 133,036,198	Y302H	probably benign	Het
Thop1	T	C	10: 81,080,194	S404P	probably benign	Het
Trp53bp1	G	T	2: 121,221,220	C988*	probably null	Het
Ube3c	A	G	5: 29,631,271	E630G	possibly damaging	Het
Usf3	T	C	16: 44,217,355	S733P	probably benign	Het
Vmn1r195	A	G	13: 22,279,019	T220A	probably benign	Het
Vmn1r201	A	T	13: 22,474,712	H32L	probably benign	Het
Wnt2	A	G	6: 18,023,240	C137R	probably damaging	Het
Ythdc2	T	C	18: 44,847,804	S489P	probably damaging	Het
Zfp248	A	G	6: 118,429,072	C418R	probably damaging	Het
Zfp946	T	G	17: 22,455,521	F419V	probably damaging	Het
Zfp994	C	T	17: 22,200,757	E404K	probably damaging	Het
Zfpm1	T	C	8: 122,334,608	V304A	possibly damaging	Het

Other mutations in Dscaml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Dscaml1	APN	9	45670200	nonsense	probably null
IGL00497:Dscaml1	APN	9	45752238	missense	probably damaging	1.00
IGL00895:Dscaml1	APN	9	45751253	missense	probably damaging	0.99
IGL01011:Dscaml1	APN	9	45683672	missense	possibly damaging	0.76
IGL01086:Dscaml1	APN	9	45702662	splice site	probably benign
IGL01125:Dscaml1	APN	9	45749632	critical splice acceptor site	probably null
IGL01132:Dscaml1	APN	9	45752328	nonsense	probably null
IGL01356:Dscaml1	APN	9	45746857	missense	probably benign	0.03
IGL01459:Dscaml1	APN	9	45742683	nonsense	probably null
IGL01552:Dscaml1	APN	9	45447908	missense	probably damaging	1.00
IGL02033:Dscaml1	APN	9	45683782	missense	probably damaging	1.00
IGL02044:Dscaml1	APN	9	45746943	nonsense	probably null
IGL02095:Dscaml1	APN	9	45447703	missense	probably damaging	1.00
IGL02166:Dscaml1	APN	9	45683701	missense	probably damaging	0.98
IGL02262:Dscaml1	APN	9	45745116	missense	probably benign
IGL02262:Dscaml1	APN	9	45732080	missense	probably benign	0.44
IGL02340:Dscaml1	APN	9	45670176	missense	possibly damaging	0.66
IGL02604:Dscaml1	APN	9	45744328	unclassified	probably benign
IGL02619:Dscaml1	APN	9	45447796	missense	probably damaging	1.00
IGL02805:Dscaml1	APN	9	45447897	missense	probably damaging	0.98
IGL03409:Dscaml1	APN	9	45670103	missense	probably damaging	1.00
D3080:Dscaml1	UTSW	9	45684325	missense	probably benign	0.44
IGL03050:Dscaml1	UTSW	9	45742999	missense	probably damaging	1.00
R0149:Dscaml1	UTSW	9	45742680	nonsense	probably null
R0582:Dscaml1	UTSW	9	45668264	missense	possibly damaging	0.77
R0629:Dscaml1	UTSW	9	45721418	missense	probably damaging	0.98
R0632:Dscaml1	UTSW	9	45732134	missense	probably benign	0.06
R0815:Dscaml1	UTSW	9	45745074	missense	probably benign	0.00
R1162:Dscaml1	UTSW	9	45752349	splice site	probably benign
R1449:Dscaml1	UTSW	9	45742223	missense	possibly damaging	0.95
R1474:Dscaml1	UTSW	9	45685221	missense	probably damaging	1.00
R1481:Dscaml1	UTSW	9	45672643	missense	probably benign	0.01
R1533:Dscaml1	UTSW	9	45450584	missense	probably damaging	0.99
R1542:Dscaml1	UTSW	9	45749440	missense	possibly damaging	0.84
R1572:Dscaml1	UTSW	9	45721333	missense	probably benign	0.00
R1627:Dscaml1	UTSW	9	45753147	missense	probably damaging	1.00
R1634:Dscaml1	UTSW	9	45672749	missense	probably damaging	1.00
R1713:Dscaml1	UTSW	9	45752690	missense	possibly damaging	0.49
R1777:Dscaml1	UTSW	9	45683756	missense	possibly damaging	0.58
R1812:Dscaml1	UTSW	9	45751286	critical splice donor site	probably null
R1834:Dscaml1	UTSW	9	45683632	missense	probably benign	0.00
R1907:Dscaml1	UTSW	9	45740480	missense	probably damaging	1.00
R1953:Dscaml1	UTSW	9	45670224	missense	probably benign	0.01
R2056:Dscaml1	UTSW	9	45750132	missense	probably damaging	0.99
R2193:Dscaml1	UTSW	9	45685234	missense	probably benign	0.21
R2497:Dscaml1	UTSW	9	45745078	missense	probably benign	0.00
R3768:Dscaml1	UTSW	9	45732137	missense	possibly damaging	0.94
R3891:Dscaml1	UTSW	9	45717484	missense	possibly damaging	0.84
R4110:Dscaml1	UTSW	9	45732068	missense	probably benign	0.07
R4706:Dscaml1	UTSW	9	45450580	missense	probably damaging	1.00
R4716:Dscaml1	UTSW	9	45450592	missense	probably damaging	1.00
R4719:Dscaml1	UTSW	9	45672695	missense	probably benign	0.13
R4770:Dscaml1	UTSW	9	45670106	missense	probably damaging	1.00
R5167:Dscaml1	UTSW	9	45717432	missense	probably damaging	1.00
R5346:Dscaml1	UTSW	9	45450559	missense	possibly damaging	0.63
R5737:Dscaml1	UTSW	9	45745185	missense	probably damaging	0.99
R5977:Dscaml1	UTSW	9	45721298	missense	probably benign	0.19
R6073:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6276:Dscaml1	UTSW	9	45668160	missense	possibly damaging	0.62
R6415:Dscaml1	UTSW	9	45683677	nonsense	probably null
R6527:Dscaml1	UTSW	9	45712184	nonsense	probably null
R6582:Dscaml1	UTSW	9	45752806	missense	probably benign	0.00
R6655:Dscaml1	UTSW	9	45746937	missense	probably benign	0.00
R6772:Dscaml1	UTSW	9	45710311	missense	probably damaging	1.00
R6799:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6892:Dscaml1	UTSW	9	45683830	missense	probably damaging	0.99
R6918:Dscaml1	UTSW	9	45430507	missense	probably benign
R6967:Dscaml1	UTSW	9	45674523	missense	probably damaging	0.97
R7214:Dscaml1	UTSW	9	45670139	missense	probably benign	0.01
R7286:Dscaml1	UTSW	9	45742746	critical splice donor site	probably null
R7315:Dscaml1	UTSW	9	45745125	missense	probably benign	0.00
R7338:Dscaml1	UTSW	9	45674504	missense	probably benign	0.12
R7343:Dscaml1	UTSW	9	45752916	missense	probably benign
R7395:Dscaml1	UTSW	9	45702405	missense	possibly damaging	0.73
R7439:Dscaml1	UTSW	9	45710326	missense	possibly damaging	0.94
R7484:Dscaml1	UTSW	9	45749446	splice site	probably null
R7545:Dscaml1	UTSW	9	45685383	missense	probably benign	0.11
R8005:Dscaml1	UTSW	9	45717510	missense	probably damaging	1.00
X0058:Dscaml1	UTSW	9	45752128	missense	probably benign	0.00
Z1177:Dscaml1	UTSW	9	45672791	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCACACATGCTCGGCTTAAC -3'
(R):5'- CTGCCAGTACATCTGCTCAC -3'

Sequencing Primer
(F):5'- ATGCTCGGCTTAACCTGCAG -3'
(R):5'- ACCTGCTACCAATCGGATGG -3'

Posted On

2016-04-15