Incidental Mutation 'R4924:Hivep1'
ID378897
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Namehuman immunodeficiency virus type I enhancer binding protein 1
SynonymsCryabp1, alphaA-CRYBP1
MMRRC Submission 042526-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R4924 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location42052021-42192537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42158316 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 1344 (S1344I)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148] [ENSMUST00000220525]
Predicted Effect probably benign
Transcript: ENSMUST00000060148
AA Change: S1344I

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: S1344I

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222491
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,011,525 H625Y probably damaging Het
Adamts4 C T 1: 171,259,074 R812W probably damaging Het
Ajuba A C 14: 54,571,599 probably null Het
Aox2 T A 1: 58,305,344 V532D probably damaging Het
Arpc1b G A 5: 145,126,815 S295N probably benign Het
Baiap2 A G 11: 119,997,024 S335G probably damaging Het
BC051142 C T 17: 34,459,977 P221L probably damaging Het
Brap T G 5: 121,665,255 N155K probably damaging Het
Btn1a1 A G 13: 23,464,226 probably benign Het
Ccl12 G A 11: 82,102,649 V38I probably benign Het
Cemip T C 7: 83,952,938 Y881C probably damaging Het
Cep128 T C 12: 91,022,400 silent Het
Chd5 A C 4: 152,366,429 D670A possibly damaging Het
Cmip T C 8: 117,257,255 Y52H probably benign Het
Dmtn A G 14: 70,617,959 I30T probably benign Het
Dscaml1 T A 9: 45,745,189 M1609K probably damaging Het
Edar C A 10: 58,629,375 E55D probably damaging Het
Ehmt1 A T 2: 24,839,722 I601N probably damaging Het
Fam120a A T 13: 48,902,096 N705K probably benign Het
Gm21718 G T 14: 51,312,835 noncoding transcript Het
Gnaz A G 10: 74,991,713 D99G probably benign Het
Helz G A 11: 107,602,339 G196D probably damaging Het
Hif1a T C 12: 73,939,557 S341P probably damaging Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Ift81 A G 5: 122,594,616 L285S possibly damaging Het
Inpp4b T A 8: 82,122,624 N891K probably damaging Het
Irx6 C T 8: 92,678,353 T283M probably benign Het
Kdm5b A G 1: 134,631,351 K1538E probably benign Het
Kif13a A G 13: 46,929,599 V8A probably damaging Het
Krtap15 T A 16: 88,829,148 N34K probably damaging Het
Lama2 T G 10: 27,369,141 I215L probably damaging Het
Ldlrad3 C T 2: 102,069,983 R58H possibly damaging Het
Lvrn C T 18: 46,894,725 P869L probably damaging Het
Myo1d A G 11: 80,674,678 F411S probably damaging Het
Myo5b T A 18: 74,695,384 H702Q probably benign Het
Nat8f4 G T 6: 85,901,419 Q41K probably benign Het
Nckap5 C A 1: 126,027,028 E596* probably null Het
Nek10 T A 14: 14,846,594 probably null Het
Notch3 T C 17: 32,144,731 Y1145C probably damaging Het
Nr4a2 A T 2: 57,112,023 H76Q probably benign Het
Nup98 T C 7: 102,134,978 Q1049R probably damaging Het
Olfr1080 A T 2: 86,553,509 F205Y probably damaging Het
Olfr1298 A T 2: 111,645,776 S74T possibly damaging Het
Olfr172 T A 16: 58,760,619 R186* probably null Het
Pepd T C 7: 35,020,984 Y231H probably benign Het
Plagl1 G T 10: 13,127,557 A190S possibly damaging Het
Plat T A 8: 22,778,253 I345N probably damaging Het
Pnmt A G 11: 98,387,460 E120G probably damaging Het
Prkrip1 C A 5: 136,198,943 probably null Het
Pygm G A 19: 6,393,724 A572T probably damaging Het
Rbm4b T C 19: 4,757,372 F39L probably damaging Het
Rpe65 A G 3: 159,622,631 H388R probably benign Het
Scn4a G T 11: 106,320,088 A1701E possibly damaging Het
Sdk2 C A 11: 113,857,758 W616L probably damaging Het
Serpina3m T A 12: 104,391,470 S218T probably benign Het
Siglece C T 7: 43,659,873 R87H probably damaging Het
Sim1 C A 10: 50,909,902 L284M probably damaging Het
Smok3c G T 5: 138,065,582 E444* probably null Het
Snx4 T C 16: 33,294,730 V427A probably benign Het
Srp68 A T 11: 116,260,858 V304E probably damaging Het
Stag1 A T 9: 100,796,755 H243L possibly damaging Het
Stx6 T C 1: 155,173,991 V14A probably damaging Het
Sv2b T A 7: 75,136,421 Y417F probably benign Het
Tas2r103 A G 6: 133,036,198 Y302H probably benign Het
Thop1 T C 10: 81,080,194 S404P probably benign Het
Trp53bp1 G T 2: 121,221,220 C988* probably null Het
Ube3c A G 5: 29,631,271 E630G possibly damaging Het
Usf3 T C 16: 44,217,355 S733P probably benign Het
Vmn1r195 A G 13: 22,279,019 T220A probably benign Het
Vmn1r201 A T 13: 22,474,712 H32L probably benign Het
Wnt2 A G 6: 18,023,240 C137R probably damaging Het
Ythdc2 T C 18: 44,847,804 S489P probably damaging Het
Zfp248 A G 6: 118,429,072 C418R probably damaging Het
Zfp946 T G 17: 22,455,521 F419V probably damaging Het
Zfp994 C T 17: 22,200,757 E404K probably damaging Het
Zfpm1 T C 8: 122,334,608 V304A possibly damaging Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42154649 missense probably benign 0.00
IGL00572:Hivep1 APN 13 42158871 missense probably benign 0.00
IGL00820:Hivep1 APN 13 42183818 missense probably benign 0.29
IGL00846:Hivep1 APN 13 42167616 nonsense probably null
IGL01068:Hivep1 APN 13 42159984 missense probably benign 0.00
IGL01431:Hivep1 APN 13 42158017 missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42159279 missense probably benign 0.18
IGL01833:Hivep1 APN 13 42154988 nonsense probably null
IGL02037:Hivep1 APN 13 42156077 missense probably benign 0.00
IGL02375:Hivep1 APN 13 42156449 missense probably benign 0.30
IGL02414:Hivep1 APN 13 42154909 missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42155654 missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42157311 missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42157685 missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42155936 missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42158904 missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42156128 missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42181671 missense
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0078:Hivep1 UTSW 13 42156041 missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42155435 missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42156153 missense probably benign
R0245:Hivep1 UTSW 13 42164290 missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42158379 missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42159756 missense probably benign 0.16
R0655:Hivep1 UTSW 13 42167585 missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42154946 missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42156962 missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42157521 missense probably benign 0.03
R1256:Hivep1 UTSW 13 42181831 missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42158043 missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42157140 missense probably benign 0.03
R1438:Hivep1 UTSW 13 42158120 missense probably benign 0.00
R1672:Hivep1 UTSW 13 42160284 missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42157931 missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42155646 missense probably benign 0.38
R1993:Hivep1 UTSW 13 42157493 missense probably benign 0.00
R2004:Hivep1 UTSW 13 42160149 missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42160124 missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42156318 missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42164393 critical splice donor site probably null
R2085:Hivep1 UTSW 13 42183750 missense probably benign 0.34
R3701:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3702:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3716:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3720:Hivep1 UTSW 13 42158601 missense probably benign 0.01
R3820:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R4379:Hivep1 UTSW 13 42155430 missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42155813 missense probably benign
R4587:Hivep1 UTSW 13 42156228 missense probably benign 0.00
R4604:Hivep1 UTSW 13 42159749 missense probably benign 0.08
R4686:Hivep1 UTSW 13 42155850 missense probably benign 0.00
R4725:Hivep1 UTSW 13 42163411 missense probably benign 0.19
R5009:Hivep1 UTSW 13 42158753 missense probably benign 0.06
R5320:Hivep1 UTSW 13 42159639 missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42164395 splice site probably null
R5498:Hivep1 UTSW 13 42123158 critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42158328 missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42156650 missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42160117 missense probably benign
R5635:Hivep1 UTSW 13 42160127 missense probably benign 0.16
R5636:Hivep1 UTSW 13 42163456 missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42156612 missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42157218 missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42160188 missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42184458 missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42158370 missense probably benign 0.01
R6247:Hivep1 UTSW 13 42157490 missense probably benign
R6343:Hivep1 UTSW 13 42159671 nonsense probably null
R6631:Hivep1 UTSW 13 42156480 missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42164284 missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42154727 missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42157081 missense probably benign 0.00
R6800:Hivep1 UTSW 13 42157376 missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42156507 missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42183452 missense probably benign 0.00
R6993:Hivep1 UTSW 13 42158714 missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42157338 missense probably benign 0.26
R7139:Hivep1 UTSW 13 42159954 missense probably benign 0.28
R7186:Hivep1 UTSW 13 42156338 missense probably benign 0.01
R7227:Hivep1 UTSW 13 42156911 missense probably benign 0.02
R7263:Hivep1 UTSW 13 42158192 missense possibly damaging 0.50
R7438:Hivep1 UTSW 13 42154911 missense probably damaging 0.99
R7490:Hivep1 UTSW 13 42157650 missense probably damaging 1.00
R7583:Hivep1 UTSW 13 42164240 missense probably damaging 1.00
R7708:Hivep1 UTSW 13 42164277 nonsense probably null
R7763:Hivep1 UTSW 13 42159461 missense probably benign 0.12
R7840:Hivep1 UTSW 13 42155352 missense probably benign
R7864:Hivep1 UTSW 13 42158814 missense probably benign 0.02
R7913:Hivep1 UTSW 13 42156366 missense probably benign 0.00
R7923:Hivep1 UTSW 13 42155352 missense probably benign
R7947:Hivep1 UTSW 13 42158814 missense probably benign 0.02
R7994:Hivep1 UTSW 13 42156366 missense probably benign 0.00
R8019:Hivep1 UTSW 13 42167622 missense
X0060:Hivep1 UTSW 13 42154985 missense probably benign 0.07
X0067:Hivep1 UTSW 13 42156717 missense probably damaging 0.98
Z1177:Hivep1 UTSW 13 42159981 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATAGAGCACTCCTCAACCG -3'
(R):5'- TTCTAGAAGGGGCACGTGTG -3'

Sequencing Primer
(F):5'- GAGTCAAGCTTCGAGTCCACTCTG -3'
(R):5'- TGCAGTGCCCCCAACAG -3'
Posted On2016-04-15