Incidental Mutation 'R4924:Myo5b'
ID 378916
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 042526-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R4924 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74828455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 702 (H702Q)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: H702Q

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: H702Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: H702Q

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: H702Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 119,902,351 (GRCm39) H625Y probably damaging Het
Adamts4 C T 1: 171,086,643 (GRCm39) R812W probably damaging Het
Ajuba A C 14: 54,809,056 (GRCm39) probably null Het
Aox1 T A 1: 58,344,503 (GRCm39) V532D probably damaging Het
Arpc1b G A 5: 145,063,625 (GRCm39) S295N probably benign Het
Baiap2 A G 11: 119,887,850 (GRCm39) S335G probably damaging Het
Brap T G 5: 121,803,318 (GRCm39) N155K probably damaging Het
Btn1a1 A G 13: 23,648,396 (GRCm39) probably benign Het
Ccl12 G A 11: 81,993,475 (GRCm39) V38I probably benign Het
Cemip T C 7: 83,602,146 (GRCm39) Y881C probably damaging Het
Cep128 T C 12: 90,989,174 (GRCm39) silent Het
Chd5 A C 4: 152,450,886 (GRCm39) D670A possibly damaging Het
Cmip T C 8: 117,983,994 (GRCm39) Y52H probably benign Het
Dmtn A G 14: 70,855,399 (GRCm39) I30T probably benign Het
Dscaml1 T A 9: 45,656,487 (GRCm39) M1609K probably damaging Het
Edar C A 10: 58,465,197 (GRCm39) E55D probably damaging Het
Ehmt1 A T 2: 24,729,734 (GRCm39) I601N probably damaging Het
Fam120a A T 13: 49,055,572 (GRCm39) N705K probably benign Het
Gm21718 G T 14: 51,550,292 (GRCm39) noncoding transcript Het
Gnaz A G 10: 74,827,545 (GRCm39) D99G probably benign Het
Helz G A 11: 107,493,165 (GRCm39) G196D probably damaging Het
Hif1a T C 12: 73,986,331 (GRCm39) S341P probably damaging Het
Hivep1 G T 13: 42,311,792 (GRCm39) S1344I probably benign Het
Hspa1l T A 17: 35,196,832 (GRCm39) Y290* probably null Het
Ift81 A G 5: 122,732,679 (GRCm39) L285S possibly damaging Het
Inpp4b T A 8: 82,849,253 (GRCm39) N891K probably damaging Het
Irx6 C T 8: 93,404,981 (GRCm39) T283M probably benign Het
Kdm5b A G 1: 134,559,089 (GRCm39) K1538E probably benign Het
Kif13a A G 13: 47,083,075 (GRCm39) V8A probably damaging Het
Krtap15-1 T A 16: 88,626,036 (GRCm39) N34K probably damaging Het
Lama2 T G 10: 27,245,137 (GRCm39) I215L probably damaging Het
Ldlrad3 C T 2: 101,900,328 (GRCm39) R58H possibly damaging Het
Lvrn C T 18: 47,027,792 (GRCm39) P869L probably damaging Het
Myo1d A G 11: 80,565,504 (GRCm39) F411S probably damaging Het
Nat8f4 G T 6: 85,878,401 (GRCm39) Q41K probably benign Het
Nckap5 C A 1: 125,954,765 (GRCm39) E596* probably null Het
Nek10 T A 14: 14,846,594 (GRCm38) probably null Het
Notch3 T C 17: 32,363,705 (GRCm39) Y1145C probably damaging Het
Nr4a2 A T 2: 57,002,035 (GRCm39) H76Q probably benign Het
Nup98 T C 7: 101,784,185 (GRCm39) Q1049R probably damaging Het
Or4k48 A T 2: 111,476,121 (GRCm39) S74T possibly damaging Het
Or5k1b T A 16: 58,580,982 (GRCm39) R186* probably null Het
Or8k33 A T 2: 86,383,853 (GRCm39) F205Y probably damaging Het
Pepd T C 7: 34,720,409 (GRCm39) Y231H probably benign Het
Plagl1 G T 10: 13,003,301 (GRCm39) A190S possibly damaging Het
Plat T A 8: 23,268,269 (GRCm39) I345N probably damaging Het
Pnmt A G 11: 98,278,286 (GRCm39) E120G probably damaging Het
Prkrip1 C A 5: 136,227,797 (GRCm39) probably null Het
Pygm G A 19: 6,443,754 (GRCm39) A572T probably damaging Het
Rbm4b T C 19: 4,807,400 (GRCm39) F39L probably damaging Het
Rpe65 A G 3: 159,328,268 (GRCm39) H388R probably benign Het
Scn4a G T 11: 106,210,914 (GRCm39) A1701E possibly damaging Het
Sdk2 C A 11: 113,748,584 (GRCm39) W616L probably damaging Het
Serpina3m T A 12: 104,357,729 (GRCm39) S218T probably benign Het
Siglece C T 7: 43,309,297 (GRCm39) R87H probably damaging Het
Sim1 C A 10: 50,785,998 (GRCm39) L284M probably damaging Het
Smok3c G T 5: 138,063,844 (GRCm39) E444* probably null Het
Snx4 T C 16: 33,115,100 (GRCm39) V427A probably benign Het
Srp68 A T 11: 116,151,684 (GRCm39) V304E probably damaging Het
Stag1 A T 9: 100,678,808 (GRCm39) H243L possibly damaging Het
Stx6 T C 1: 155,049,737 (GRCm39) V14A probably damaging Het
Sv2b T A 7: 74,786,169 (GRCm39) Y417F probably benign Het
Tas2r103 A G 6: 133,013,161 (GRCm39) Y302H probably benign Het
Thop1 T C 10: 80,916,028 (GRCm39) S404P probably benign Het
Trp53bp1 G T 2: 121,051,701 (GRCm39) C988* probably null Het
Tsbp1 C T 17: 34,678,951 (GRCm39) P221L probably damaging Het
Ube3c A G 5: 29,836,269 (GRCm39) E630G possibly damaging Het
Usf3 T C 16: 44,037,718 (GRCm39) S733P probably benign Het
Vmn1r195 A G 13: 22,463,189 (GRCm39) T220A probably benign Het
Vmn1r201 A T 13: 22,658,882 (GRCm39) H32L probably benign Het
Wnt2 A G 6: 18,023,239 (GRCm39) C137R probably damaging Het
Ythdc2 T C 18: 44,980,871 (GRCm39) S489P probably damaging Het
Zfp248 A G 6: 118,406,033 (GRCm39) C418R probably damaging Het
Zfp946 T G 17: 22,674,502 (GRCm39) F419V probably damaging Het
Zfp994 C T 17: 22,419,738 (GRCm39) E404K probably damaging Het
Zfpm1 T C 8: 123,061,347 (GRCm39) V304A possibly damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTCAGGGATGCTGACACACTG -3'
(R):5'- AGTCTCTGTTGTAGGAAATGGC -3'

Sequencing Primer
(F):5'- ATGCTGACACACTGGGGTTC -3'
(R):5'- GGAAATGGCTTAACATCTCTGG -3'
Posted On 2016-04-15