Incidental Mutation 'R4925:Tpr'
ID378923
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4925 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 150432565 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1690 (H1690Q)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect probably benign
Transcript: ENSMUST00000119161
AA Change: H1616Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: H1616Q

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
AA Change: H1690Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: H1690Q

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150752
Predicted Effect unknown
Transcript: ENSMUST00000151563
AA Change: H222Q
SMART Domains Protein: ENSMUSP00000116012
Gene: ENSMUSG00000006005
AA Change: H222Q

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 79 235 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 368 384 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 588 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
Pouch UTSW 1 150433772 missense probably damaging 1.00
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 splice site probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7973:Tpr UTSW 1 150403887 missense probably damaging 1.00
R8013:Tpr UTSW 1 150398608 missense probably benign
R8220:Tpr UTSW 1 150432413 missense probably benign 0.05
R8274:Tpr UTSW 1 150423479 splice site probably benign
R8428:Tpr UTSW 1 150414813 missense probably damaging 1.00
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCAGGATGTAATGCTAACTGTAC -3'
(R):5'- TTTATTACACCCAAACGTCCACTG -3'

Sequencing Primer
(F):5'- GGATGTAATGCTAACTGTACATGCC -3'
(R):5'- AAACGTCCACTGAACAAAGATG -3'
Posted On2016-04-15