Mutagenetix > Incidental Mutation

Incidental Mutation 'R4925:Rgsl1'

378924

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4925 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 153812277 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 657 (Y657F)

Ref Sequence

ENSEMBL: ENSMUSP00000139340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000141249] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

probably benign
Transcript: ENSMUST00000124558
AA Change: Y622F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: Y622F

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134030

Predicted Effect

probably benign
Transcript: ENSMUST00000141249

SMART Domains

Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641

Domain	Start	End	E-Value	Type
Blast:RGS	3	300	3e-30	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

probably benign
Transcript: ENSMUST00000185164
AA Change: Y657F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: Y657F

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206321

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,425,714	C173*	probably null	Het
2210407C18Rik	T	A	11: 58,610,687	T157S	probably damaging	Het
3425401B19Rik	T	A	14: 32,663,180	H276L	possibly damaging	Het
4930430A15Rik	T	C	2: 111,218,616	K273E	probably benign	Het
Adam21	T	G	12: 81,560,389	M200L	probably benign	Het
Adamts3	A	T	5: 89,684,323	S974T	probably benign	Het
Adamtsl3	T	A	7: 82,602,299		probably null	Het
Atp8b2	A	G	3: 89,946,623		probably null	Het
Brd8	T	C	18: 34,607,335	T552A	probably benign	Het
Btaf1	A	G	19: 37,011,333	S1826G	probably benign	Het
C330027C09Rik	T	C	16: 49,016,363		probably null	Het
Ccdc163	A	G	4: 116,711,331	E77G	possibly damaging	Het
Ces2g	A	G	8: 104,964,894	R194G	probably benign	Het
Cln8	A	G	8: 14,895,004	H106R	possibly damaging	Het
Col12a1	T	G	9: 79,674,795	L1391F	probably damaging	Het
Col16a1	G	A	4: 130,054,176	D230N	probably damaging	Het
Crhbp	C	A	13: 95,443,810	G87V	possibly damaging	Het
Cyp3a16	C	T	5: 145,452,834	M240I	probably benign	Het
Cyp4a14	A	T	4: 115,495,936	W60R	possibly damaging	Het
Fam47e	A	G	5: 92,585,290	Y304C	probably damaging	Het
Fgfbp1	A	T	5: 43,979,292	D219E	probably damaging	Het
Fgfr2	A	T	7: 130,185,272	Y485N	probably damaging	Het
Fhdc1	C	T	3: 84,453,533	V363M	probably damaging	Het
Foxb1	T	A	9: 69,760,155	E31V	probably damaging	Het
Galnt9	T	C	5: 110,544,739	V13A	possibly damaging	Het
Ghrl	T	C	6: 113,716,257	D77G	probably damaging	Het
Gm21731	A	G	13: 120,240,848	Y60C	probably damaging	Het
Gpr85	A	G	6: 13,835,978	V309A	probably benign	Het
Greb1	T	C	12: 16,681,471	Y1622C	probably damaging	Het
Greb1l	T	A	18: 10,547,447	M1555K	possibly damaging	Het
Grin2a	T	A	16: 9,669,823	N404Y	probably damaging	Het
Gtpbp1	A	C	15: 79,715,968	I399L	probably benign	Het
Hectd4	T	C	5: 121,322,690	S911P	possibly damaging	Het
Igkc	A	T	6: 70,726,536	K34*	probably null	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Iqgap1	T	A	7: 80,765,317	I149F	probably damaging	Het
Lama1	C	T	17: 67,794,314	A1934V	probably benign	Het
Lrp1	C	A	10: 127,575,075	E1415*	probably null	Het
Macf1	A	C	4: 123,526,652	C270G	probably benign	Het
Marveld3	A	G	8: 109,948,311	V291A	probably benign	Het
Med23	T	C	10: 24,910,747	F917S	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Ncan	A	T	8: 70,109,954	D551E	probably benign	Het
Olfr1269	T	A	2: 90,118,777	T274S	probably damaging	Het
Olfr382	A	T	11: 73,517,172	I9N	possibly damaging	Het
Olfr649	T	C	7: 104,190,180	Y9C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pla2g12a	T	C	3: 129,878,818	W34R	probably damaging	Het
Plekha7	A	G	7: 116,158,128	F529S	probably damaging	Het
Ppl	T	A	16: 5,104,982	D215V	probably damaging	Het
Pramef20	A	T	4: 144,377,932	M1K	probably null	Het
Prdm1	T	A	10: 44,440,169	Y690F	probably damaging	Het
Prkcd	T	A	14: 30,607,613	D124V	probably damaging	Het
Ptprc	C	A	1: 138,099,497	D538Y	probably benign	Het
Rasl10b	G	A	11: 83,412,679	V21M	probably damaging	Het
Rrn3	T	C	16: 13,799,972	C360R	probably damaging	Het
Scarb1	T	C	5: 125,297,299	T257A	probably damaging	Het
Serpinb2	T	A	1: 107,515,489	M6K	probably benign	Het
Slco4a1	T	C	2: 180,472,056	Y429H	probably benign	Het
St13	G	C	15: 81,399,585	R4G	probably benign	Het
Taar3	T	A	10: 23,950,543	F329Y	probably damaging	Het
Tardbp	A	T	4: 148,618,651	N285K	probably benign	Het
Tnni2	A	T	7: 142,442,693	E4V	probably benign	Het
Tnpo2	A	T	8: 85,050,025	I454F	probably damaging	Het
Tpr	T	G	1: 150,432,565	H1690Q	probably benign	Het
Trav18	T	C	14: 53,831,120	S6P	probably benign	Het
Trf	T	C	9: 103,219,246	N25S	probably benign	Het
Vmn1r59	T	C	7: 5,454,116	N215S	probably benign	Het
Vmn2r2	T	C	3: 64,137,471	M1V	probably null	Het
Wdr64	T	C	1: 175,724,702		probably null	Het
Wdr73	T	C	7: 80,893,195	S222G	probably benign	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- AAAGTGTCTTGTTCCTATGCGTATG -3'
(R):5'- CTGGCCAGTGTCTCTAAGAAAG -3'

Sequencing Primer
(F):5'- CTTGTTCCTATGCGTATGATCTATAG -3'
(R):5'- CCAGTGTCTCTAAGAAAGGTGAGCTC -3'

Posted On

2016-04-15