Incidental Mutation 'R4925:Rgsl1'
ID 378924
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Name regulator of G-protein signaling like 1
Synonyms 4930415K13Rik, Rgsl2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 153655127-153719888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 153688023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 657 (Y657F)
Ref Sequence ENSEMBL: ENSMUSP00000139340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000141249] [ENSMUST00000185164]
AlphaFold A0A5F8MPV0
Predicted Effect probably benign
Transcript: ENSMUST00000124558
AA Change: Y622F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: Y622F

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134030
Predicted Effect probably benign
Transcript: ENSMUST00000141249
SMART Domains Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641

DomainStartEndE-ValueType
Blast:RGS 3 300 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably benign
Transcript: ENSMUST00000185164
AA Change: Y657F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: Y657F

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206321
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,316,540 (GRCm39) C173* probably null Het
3425401B19Rik T A 14: 32,385,137 (GRCm39) H276L possibly damaging Het
Adam21 T G 12: 81,607,163 (GRCm39) M200L probably benign Het
Adamts3 A T 5: 89,832,182 (GRCm39) S974T probably benign Het
Adamtsl3 T A 7: 82,251,507 (GRCm39) probably null Het
Atp8b2 A G 3: 89,853,930 (GRCm39) probably null Het
Brd8 T C 18: 34,740,388 (GRCm39) T552A probably benign Het
Btaf1 A G 19: 36,988,733 (GRCm39) S1826G probably benign Het
Ccdc163 A G 4: 116,568,528 (GRCm39) E77G possibly damaging Het
Ces2g A G 8: 105,691,526 (GRCm39) R194G probably benign Het
Cip2a T C 16: 48,836,726 (GRCm39) probably null Het
Cln8 A G 8: 14,945,004 (GRCm39) H106R possibly damaging Het
Col12a1 T G 9: 79,582,077 (GRCm39) L1391F probably damaging Het
Col16a1 G A 4: 129,947,969 (GRCm39) D230N probably damaging Het
Crhbp C A 13: 95,580,318 (GRCm39) G87V possibly damaging Het
Cyp3a16 C T 5: 145,389,644 (GRCm39) M240I probably benign Het
Cyp4a14 A T 4: 115,353,133 (GRCm39) W60R possibly damaging Het
Fam47e A G 5: 92,733,149 (GRCm39) Y304C probably damaging Het
Fgfbp1 A T 5: 44,136,634 (GRCm39) D219E probably damaging Het
Fgfr2 A T 7: 129,787,002 (GRCm39) Y485N probably damaging Het
Fhdc1 C T 3: 84,360,840 (GRCm39) V363M probably damaging Het
Foxb1 T A 9: 69,667,437 (GRCm39) E31V probably damaging Het
Galnt9 T C 5: 110,692,605 (GRCm39) V13A possibly damaging Het
Ghrl T C 6: 113,693,218 (GRCm39) D77G probably damaging Het
Gpr85 A G 6: 13,835,977 (GRCm39) V309A probably benign Het
Greb1 T C 12: 16,731,472 (GRCm39) Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 (GRCm39) M1555K possibly damaging Het
Grin2a T A 16: 9,487,687 (GRCm39) N404Y probably damaging Het
Gtpbp1 A C 15: 79,600,169 (GRCm39) I399L probably benign Het
Hectd4 T C 5: 121,460,753 (GRCm39) S911P possibly damaging Het
Igkc A T 6: 70,703,520 (GRCm39) K34* probably null Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Iqgap1 T A 7: 80,415,065 (GRCm39) I149F probably damaging Het
Lama1 C T 17: 68,101,309 (GRCm39) A1934V probably benign Het
Lrp1 C A 10: 127,410,944 (GRCm39) E1415* probably null Het
Lypd8l T A 11: 58,501,513 (GRCm39) T157S probably damaging Het
Macf1 A C 4: 123,420,445 (GRCm39) C270G probably benign Het
Marveld3 A G 8: 110,674,943 (GRCm39) V291A probably benign Het
Med23 T C 10: 24,786,645 (GRCm39) F917S probably damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Ncan A T 8: 70,562,604 (GRCm39) D551E probably benign Het
Or1e23 A T 11: 73,407,998 (GRCm39) I9N possibly damaging Het
Or4x6 T A 2: 89,949,121 (GRCm39) T274S probably damaging Het
Or52h2 T C 7: 103,839,387 (GRCm39) Y9C possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pla2g12a T C 3: 129,672,467 (GRCm39) W34R probably damaging Het
Plekha7 A G 7: 115,757,363 (GRCm39) F529S probably damaging Het
Potefam1 T C 2: 111,048,961 (GRCm39) K273E probably benign Het
Ppl T A 16: 4,922,846 (GRCm39) D215V probably damaging Het
Pramel15 A T 4: 144,104,502 (GRCm39) M1K probably null Het
Prdm1 T A 10: 44,316,165 (GRCm39) Y690F probably damaging Het
Prkcd T A 14: 30,329,570 (GRCm39) D124V probably damaging Het
Ptprc C A 1: 138,027,235 (GRCm39) D538Y probably benign Het
Rasl10b G A 11: 83,303,505 (GRCm39) V21M probably damaging Het
Rrn3 T C 16: 13,617,836 (GRCm39) C360R probably damaging Het
Scarb1 T C 5: 125,374,363 (GRCm39) T257A probably damaging Het
Serpinb2 T A 1: 107,443,219 (GRCm39) M6K probably benign Het
Slco4a1 T C 2: 180,113,849 (GRCm39) Y429H probably benign Het
St13 G C 15: 81,283,786 (GRCm39) R4G probably benign Het
Taar3 T A 10: 23,826,441 (GRCm39) F329Y probably damaging Het
Tardbp A T 4: 148,703,108 (GRCm39) N285K probably benign Het
Tcstv7b A G 13: 120,702,384 (GRCm39) Y60C probably damaging Het
Tnni2 A T 7: 141,996,430 (GRCm39) E4V probably benign Het
Tnpo2 A T 8: 85,776,654 (GRCm39) I454F probably damaging Het
Tpr T G 1: 150,308,316 (GRCm39) H1690Q probably benign Het
Trav18 T C 14: 54,068,577 (GRCm39) S6P probably benign Het
Trf T C 9: 103,096,445 (GRCm39) N25S probably benign Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r2 T C 3: 64,044,892 (GRCm39) M1V probably null Het
Wdr64 T C 1: 175,552,268 (GRCm39) probably null Het
Wdr73 T C 7: 80,542,943 (GRCm39) S222G probably benign Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153,701,887 (GRCm39) missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153,669,513 (GRCm39) missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153,679,755 (GRCm39) splice site probably null
IGL02409:Rgsl1 APN 1 153,701,989 (GRCm39) missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153,675,684 (GRCm39) missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153,701,236 (GRCm39) missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153,683,454 (GRCm39) missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153,701,948 (GRCm39) missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153,675,693 (GRCm39) missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153,701,687 (GRCm39) missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153,701,587 (GRCm39) missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153,669,501 (GRCm39) missense probably null 0.82
Bam UTSW 1 153,669,898 (GRCm39) missense probably benign 0.00
Candygram UTSW 1 153,697,245 (GRCm39) nonsense probably null
wham UTSW 1 153,678,038 (GRCm39) missense probably benign 0.02
IGL03050:Rgsl1 UTSW 1 153,701,422 (GRCm39) missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153,701,716 (GRCm39) missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153,669,510 (GRCm39) missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153,701,927 (GRCm39) missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153,719,853 (GRCm39) missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153,678,074 (GRCm39) missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153,677,980 (GRCm39) critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153,660,937 (GRCm39) missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153,683,507 (GRCm39) start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153,701,672 (GRCm39) missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153,680,422 (GRCm39) missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153,680,422 (GRCm39) missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153,675,543 (GRCm39) missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153,701,651 (GRCm39) missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153,693,295 (GRCm39) missense probably benign
R2116:Rgsl1 UTSW 1 153,693,295 (GRCm39) missense probably benign
R2176:Rgsl1 UTSW 1 153,701,014 (GRCm39) splice site probably benign
R2229:Rgsl1 UTSW 1 153,698,104 (GRCm39) missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153,703,294 (GRCm39) missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153,679,876 (GRCm39) critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153,693,330 (GRCm39) missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153,678,087 (GRCm39) missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153,703,282 (GRCm39) missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153,693,328 (GRCm39) missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153,669,514 (GRCm39) missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153,697,268 (GRCm39) nonsense probably null
R5304:Rgsl1 UTSW 1 153,703,238 (GRCm39) missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153,678,038 (GRCm39) missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153,666,053 (GRCm39) missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153,666,053 (GRCm39) missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153,669,520 (GRCm39) missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153,701,639 (GRCm39) missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153,675,618 (GRCm39) missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153,687,984 (GRCm39) missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153,679,767 (GRCm39) missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153,703,194 (GRCm39) missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153,703,211 (GRCm39) missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153,703,291 (GRCm39) missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153,698,117 (GRCm39) missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153,697,292 (GRCm39) missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153,701,512 (GRCm39) missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153,698,063 (GRCm39) missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153,697,245 (GRCm39) nonsense probably null
R6974:Rgsl1 UTSW 1 153,675,568 (GRCm39) missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153,701,966 (GRCm39) missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153,660,945 (GRCm39) missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153,679,876 (GRCm39) critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153,683,622 (GRCm39) critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153,669,591 (GRCm39) missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153,719,847 (GRCm39) critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153,701,225 (GRCm39) missense probably benign
R7703:Rgsl1 UTSW 1 153,669,610 (GRCm39) missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153,701,783 (GRCm39) missense possibly damaging 0.53
R8408:Rgsl1 UTSW 1 153,701,435 (GRCm39) missense possibly damaging 0.96
R8860:Rgsl1 UTSW 1 153,697,100 (GRCm39) nonsense probably null
R8894:Rgsl1 UTSW 1 153,698,119 (GRCm39) critical splice acceptor site probably null
R9043:Rgsl1 UTSW 1 153,717,567 (GRCm39) missense possibly damaging 0.73
R9187:Rgsl1 UTSW 1 153,669,613 (GRCm39) missense possibly damaging 0.53
R9280:Rgsl1 UTSW 1 153,669,898 (GRCm39) missense probably benign 0.00
R9326:Rgsl1 UTSW 1 153,679,768 (GRCm39) missense probably benign 0.01
R9388:Rgsl1 UTSW 1 153,693,355 (GRCm39) missense probably benign
R9479:Rgsl1 UTSW 1 153,657,445 (GRCm39) missense unknown
X0020:Rgsl1 UTSW 1 153,701,131 (GRCm39) missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153,679,779 (GRCm39) missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153,701,734 (GRCm39) missense not run
Z1177:Rgsl1 UTSW 1 153,693,356 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAAGTGTCTTGTTCCTATGCGTATG -3'
(R):5'- CTGGCCAGTGTCTCTAAGAAAG -3'

Sequencing Primer
(F):5'- CTTGTTCCTATGCGTATGATCTATAG -3'
(R):5'- CCAGTGTCTCTAAGAAAGGTGAGCTC -3'
Posted On 2016-04-15