Incidental Mutation 'R4925:Cyp3a16'
ID378950
Institutional Source Beutler Lab
Gene Symbol Cyp3a16
Ensembl Gene ENSMUSG00000038656
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 16
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4925 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145436309-145469723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145452834 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 240 (M240I)
Ref Sequence ENSEMBL: ENSMUSP00000031633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031633]
Predicted Effect probably benign
Transcript: ENSMUST00000031633
AA Change: M240I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031633
Gene: ENSMUSG00000038656
AA Change: M240I

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 5.5e-132 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Cyp3a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Cyp3a16 APN 5 145440434 missense probably damaging 0.98
IGL01964:Cyp3a16 APN 5 145455562 missense probably benign 0.41
IGL02007:Cyp3a16 APN 5 145441948 splice site probably benign
IGL02139:Cyp3a16 APN 5 145455480 missense probably benign 0.10
IGL02177:Cyp3a16 APN 5 145450154 missense probably benign 0.43
IGL02407:Cyp3a16 APN 5 145451842 missense probably damaging 0.99
IGL02473:Cyp3a16 APN 5 145440494 missense possibly damaging 0.54
polywog UTSW 5 145467470 nonsense probably null
R0363:Cyp3a16 UTSW 5 145455879 splice site probably benign
R0556:Cyp3a16 UTSW 5 145455980 missense probably benign 0.37
R0557:Cyp3a16 UTSW 5 145469588 missense unknown
R0636:Cyp3a16 UTSW 5 145463085 missense probably benign 0.03
R0749:Cyp3a16 UTSW 5 145456177 critical splice acceptor site probably null
R0788:Cyp3a16 UTSW 5 145465076 missense probably benign 0.00
R1552:Cyp3a16 UTSW 5 145436536 missense probably benign 0.01
R1575:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R1580:Cyp3a16 UTSW 5 145442074 missense possibly damaging 0.94
R1580:Cyp3a16 UTSW 5 145442075 missense probably damaging 1.00
R1642:Cyp3a16 UTSW 5 145469589 missense unknown
R1763:Cyp3a16 UTSW 5 145465031 critical splice donor site probably null
R2029:Cyp3a16 UTSW 5 145451857 missense probably damaging 0.96
R2144:Cyp3a16 UTSW 5 145456084 missense probably damaging 1.00
R2409:Cyp3a16 UTSW 5 145440367 missense probably benign 0.01
R2473:Cyp3a16 UTSW 5 145455594 missense possibly damaging 0.79
R2860:Cyp3a16 UTSW 5 145455499 nonsense probably null
R2861:Cyp3a16 UTSW 5 145455499 nonsense probably null
R3747:Cyp3a16 UTSW 5 145442071 missense probably damaging 1.00
R4654:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R4781:Cyp3a16 UTSW 5 145456112 missense possibly damaging 0.85
R4873:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4875:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R5365:Cyp3a16 UTSW 5 145452787 missense probably damaging 1.00
R5496:Cyp3a16 UTSW 5 145467531 missense probably damaging 1.00
R5640:Cyp3a16 UTSW 5 145452823 missense possibly damaging 0.94
R5761:Cyp3a16 UTSW 5 145442033 missense possibly damaging 0.79
R6401:Cyp3a16 UTSW 5 145440364 missense probably damaging 1.00
R6526:Cyp3a16 UTSW 5 145455895 missense probably benign 0.01
R6528:Cyp3a16 UTSW 5 145440431 missense probably damaging 1.00
R7000:Cyp3a16 UTSW 5 145463170 critical splice acceptor site probably null
R7268:Cyp3a16 UTSW 5 145467470 nonsense probably null
R7630:Cyp3a16 UTSW 5 145436310 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCAGGATGTTCTAGCTTTTATCCC -3'
(R):5'- TATGGTGCTGACCCAGTGTG -3'

Sequencing Primer
(F):5'- TCTAGCTTTTATCCCCTTGATAAGG -3'
(R):5'- TGACCCAGTGTGAGCAAGTTC -3'
Posted On2016-04-15