Incidental Mutation 'R4925:Cyp3a16'
ID 378950
Institutional Source Beutler Lab
Gene Symbol Cyp3a16
Ensembl Gene ENSMUSG00000038656
Gene Name cytochrome P450, family 3, subfamily a, polypeptide 16
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 145373119-145406533 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 145389644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 240 (M240I)
Ref Sequence ENSEMBL: ENSMUSP00000031633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031633]
AlphaFold Q64481
Predicted Effect probably benign
Transcript: ENSMUST00000031633
AA Change: M240I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031633
Gene: ENSMUSG00000038656
AA Change: M240I

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 5.5e-132 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,316,540 (GRCm39) C173* probably null Het
3425401B19Rik T A 14: 32,385,137 (GRCm39) H276L possibly damaging Het
Adam21 T G 12: 81,607,163 (GRCm39) M200L probably benign Het
Adamts3 A T 5: 89,832,182 (GRCm39) S974T probably benign Het
Adamtsl3 T A 7: 82,251,507 (GRCm39) probably null Het
Atp8b2 A G 3: 89,853,930 (GRCm39) probably null Het
Brd8 T C 18: 34,740,388 (GRCm39) T552A probably benign Het
Btaf1 A G 19: 36,988,733 (GRCm39) S1826G probably benign Het
Ccdc163 A G 4: 116,568,528 (GRCm39) E77G possibly damaging Het
Ces2g A G 8: 105,691,526 (GRCm39) R194G probably benign Het
Cip2a T C 16: 48,836,726 (GRCm39) probably null Het
Cln8 A G 8: 14,945,004 (GRCm39) H106R possibly damaging Het
Col12a1 T G 9: 79,582,077 (GRCm39) L1391F probably damaging Het
Col16a1 G A 4: 129,947,969 (GRCm39) D230N probably damaging Het
Crhbp C A 13: 95,580,318 (GRCm39) G87V possibly damaging Het
Cyp4a14 A T 4: 115,353,133 (GRCm39) W60R possibly damaging Het
Fam47e A G 5: 92,733,149 (GRCm39) Y304C probably damaging Het
Fgfbp1 A T 5: 44,136,634 (GRCm39) D219E probably damaging Het
Fgfr2 A T 7: 129,787,002 (GRCm39) Y485N probably damaging Het
Fhdc1 C T 3: 84,360,840 (GRCm39) V363M probably damaging Het
Foxb1 T A 9: 69,667,437 (GRCm39) E31V probably damaging Het
Galnt9 T C 5: 110,692,605 (GRCm39) V13A possibly damaging Het
Ghrl T C 6: 113,693,218 (GRCm39) D77G probably damaging Het
Gpr85 A G 6: 13,835,977 (GRCm39) V309A probably benign Het
Greb1 T C 12: 16,731,472 (GRCm39) Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 (GRCm39) M1555K possibly damaging Het
Grin2a T A 16: 9,487,687 (GRCm39) N404Y probably damaging Het
Gtpbp1 A C 15: 79,600,169 (GRCm39) I399L probably benign Het
Hectd4 T C 5: 121,460,753 (GRCm39) S911P possibly damaging Het
Igkc A T 6: 70,703,520 (GRCm39) K34* probably null Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Iqgap1 T A 7: 80,415,065 (GRCm39) I149F probably damaging Het
Lama1 C T 17: 68,101,309 (GRCm39) A1934V probably benign Het
Lrp1 C A 10: 127,410,944 (GRCm39) E1415* probably null Het
Lypd8l T A 11: 58,501,513 (GRCm39) T157S probably damaging Het
Macf1 A C 4: 123,420,445 (GRCm39) C270G probably benign Het
Marveld3 A G 8: 110,674,943 (GRCm39) V291A probably benign Het
Med23 T C 10: 24,786,645 (GRCm39) F917S probably damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Ncan A T 8: 70,562,604 (GRCm39) D551E probably benign Het
Or1e23 A T 11: 73,407,998 (GRCm39) I9N possibly damaging Het
Or4x6 T A 2: 89,949,121 (GRCm39) T274S probably damaging Het
Or52h2 T C 7: 103,839,387 (GRCm39) Y9C possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pla2g12a T C 3: 129,672,467 (GRCm39) W34R probably damaging Het
Plekha7 A G 7: 115,757,363 (GRCm39) F529S probably damaging Het
Potefam1 T C 2: 111,048,961 (GRCm39) K273E probably benign Het
Ppl T A 16: 4,922,846 (GRCm39) D215V probably damaging Het
Pramel15 A T 4: 144,104,502 (GRCm39) M1K probably null Het
Prdm1 T A 10: 44,316,165 (GRCm39) Y690F probably damaging Het
Prkcd T A 14: 30,329,570 (GRCm39) D124V probably damaging Het
Ptprc C A 1: 138,027,235 (GRCm39) D538Y probably benign Het
Rasl10b G A 11: 83,303,505 (GRCm39) V21M probably damaging Het
Rgsl1 T A 1: 153,688,023 (GRCm39) Y657F probably benign Het
Rrn3 T C 16: 13,617,836 (GRCm39) C360R probably damaging Het
Scarb1 T C 5: 125,374,363 (GRCm39) T257A probably damaging Het
Serpinb2 T A 1: 107,443,219 (GRCm39) M6K probably benign Het
Slco4a1 T C 2: 180,113,849 (GRCm39) Y429H probably benign Het
St13 G C 15: 81,283,786 (GRCm39) R4G probably benign Het
Taar3 T A 10: 23,826,441 (GRCm39) F329Y probably damaging Het
Tardbp A T 4: 148,703,108 (GRCm39) N285K probably benign Het
Tcstv7b A G 13: 120,702,384 (GRCm39) Y60C probably damaging Het
Tnni2 A T 7: 141,996,430 (GRCm39) E4V probably benign Het
Tnpo2 A T 8: 85,776,654 (GRCm39) I454F probably damaging Het
Tpr T G 1: 150,308,316 (GRCm39) H1690Q probably benign Het
Trav18 T C 14: 54,068,577 (GRCm39) S6P probably benign Het
Trf T C 9: 103,096,445 (GRCm39) N25S probably benign Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r2 T C 3: 64,044,892 (GRCm39) M1V probably null Het
Wdr64 T C 1: 175,552,268 (GRCm39) probably null Het
Wdr73 T C 7: 80,542,943 (GRCm39) S222G probably benign Het
Other mutations in Cyp3a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Cyp3a16 APN 5 145,377,244 (GRCm39) missense probably damaging 0.98
IGL01964:Cyp3a16 APN 5 145,392,372 (GRCm39) missense probably benign 0.41
IGL02007:Cyp3a16 APN 5 145,378,758 (GRCm39) splice site probably benign
IGL02139:Cyp3a16 APN 5 145,392,290 (GRCm39) missense probably benign 0.10
IGL02177:Cyp3a16 APN 5 145,386,964 (GRCm39) missense probably benign 0.43
IGL02407:Cyp3a16 APN 5 145,388,652 (GRCm39) missense probably damaging 0.99
IGL02473:Cyp3a16 APN 5 145,377,304 (GRCm39) missense possibly damaging 0.54
polywog UTSW 5 145,404,280 (GRCm39) nonsense probably null
R0363:Cyp3a16 UTSW 5 145,392,689 (GRCm39) splice site probably benign
R0556:Cyp3a16 UTSW 5 145,392,790 (GRCm39) missense probably benign 0.37
R0557:Cyp3a16 UTSW 5 145,406,398 (GRCm39) missense unknown
R0636:Cyp3a16 UTSW 5 145,399,895 (GRCm39) missense probably benign 0.03
R0749:Cyp3a16 UTSW 5 145,392,987 (GRCm39) critical splice acceptor site probably null
R0788:Cyp3a16 UTSW 5 145,401,886 (GRCm39) missense probably benign 0.00
R1552:Cyp3a16 UTSW 5 145,373,346 (GRCm39) missense probably benign 0.01
R1575:Cyp3a16 UTSW 5 145,373,267 (GRCm39) missense probably benign 0.01
R1580:Cyp3a16 UTSW 5 145,378,885 (GRCm39) missense probably damaging 1.00
R1580:Cyp3a16 UTSW 5 145,378,884 (GRCm39) missense possibly damaging 0.94
R1642:Cyp3a16 UTSW 5 145,406,399 (GRCm39) missense unknown
R1763:Cyp3a16 UTSW 5 145,401,841 (GRCm39) critical splice donor site probably null
R2029:Cyp3a16 UTSW 5 145,388,667 (GRCm39) missense probably damaging 0.96
R2144:Cyp3a16 UTSW 5 145,392,894 (GRCm39) missense probably damaging 1.00
R2409:Cyp3a16 UTSW 5 145,377,177 (GRCm39) missense probably benign 0.01
R2473:Cyp3a16 UTSW 5 145,392,404 (GRCm39) missense possibly damaging 0.79
R2860:Cyp3a16 UTSW 5 145,392,309 (GRCm39) nonsense probably null
R2861:Cyp3a16 UTSW 5 145,392,309 (GRCm39) nonsense probably null
R3747:Cyp3a16 UTSW 5 145,378,881 (GRCm39) missense probably damaging 1.00
R4654:Cyp3a16 UTSW 5 145,373,267 (GRCm39) missense probably benign 0.01
R4781:Cyp3a16 UTSW 5 145,392,922 (GRCm39) missense possibly damaging 0.85
R4873:Cyp3a16 UTSW 5 145,389,659 (GRCm39) missense probably benign 0.01
R4875:Cyp3a16 UTSW 5 145,389,659 (GRCm39) missense probably benign 0.01
R5365:Cyp3a16 UTSW 5 145,389,597 (GRCm39) missense probably damaging 1.00
R5496:Cyp3a16 UTSW 5 145,404,341 (GRCm39) missense probably damaging 1.00
R5640:Cyp3a16 UTSW 5 145,389,633 (GRCm39) missense possibly damaging 0.94
R5761:Cyp3a16 UTSW 5 145,378,843 (GRCm39) missense possibly damaging 0.79
R6401:Cyp3a16 UTSW 5 145,377,174 (GRCm39) missense probably damaging 1.00
R6526:Cyp3a16 UTSW 5 145,392,705 (GRCm39) missense probably benign 0.01
R6528:Cyp3a16 UTSW 5 145,377,241 (GRCm39) missense probably damaging 1.00
R7000:Cyp3a16 UTSW 5 145,399,980 (GRCm39) critical splice acceptor site probably null
R7268:Cyp3a16 UTSW 5 145,404,280 (GRCm39) nonsense probably null
R7630:Cyp3a16 UTSW 5 145,373,120 (GRCm39) splice site probably null
R7938:Cyp3a16 UTSW 5 145,389,666 (GRCm39) missense probably benign 0.00
R8827:Cyp3a16 UTSW 5 145,387,008 (GRCm39) missense probably benign 0.38
R9040:Cyp3a16 UTSW 5 145,392,922 (GRCm39) missense possibly damaging 0.85
R9137:Cyp3a16 UTSW 5 145,406,413 (GRCm39) missense unknown
R9139:Cyp3a16 UTSW 5 145,406,434 (GRCm39) missense unknown
R9140:Cyp3a16 UTSW 5 145,406,434 (GRCm39) missense unknown
R9284:Cyp3a16 UTSW 5 145,377,304 (GRCm39) missense probably damaging 1.00
R9657:Cyp3a16 UTSW 5 145,386,979 (GRCm39) missense probably null 1.00
R9680:Cyp3a16 UTSW 5 145,389,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGATGTTCTAGCTTTTATCCC -3'
(R):5'- TATGGTGCTGACCCAGTGTG -3'

Sequencing Primer
(F):5'- TCTAGCTTTTATCCCCTTGATAAGG -3'
(R):5'- TGACCCAGTGTGAGCAAGTTC -3'
Posted On 2016-04-15