Incidental Mutation 'R4925:Gpr85'
ID 378951
Institutional Source Beutler Lab
Gene Symbol Gpr85
Ensembl Gene ENSMUSG00000048216
Gene Name G protein-coupled receptor 85
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 13834458-13839942 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13835978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000111155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060442] [ENSMUST00000115491] [ENSMUST00000115492]
AlphaFold P60894
Predicted Effect probably benign
Transcript: ENSMUST00000060442
AA Change: V309A

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053837
Gene: ENSMUSG00000048216
AA Change: V309A

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115491
AA Change: V309A

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111154
Gene: ENSMUSG00000048216
AA Change: V309A

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115492
AA Change: V309A

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111155
Gene: ENSMUSG00000048216
AA Change: V309A

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 1.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127072
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the G protein-coupled receptor (GPCR) family, such as GPR85, have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli, such as neurotransmitters, hormones, or light, induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins (Matsumoto et al., 2000 [PubMed 10833454]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a significant increase in brain weight and enhanced contextual memory in a fear-conditioning task but no additional behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Gpr85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Gpr85 APN 6 13836910 utr 5 prime probably benign
R0784:Gpr85 UTSW 6 13836749 missense probably benign 0.25
R1356:Gpr85 UTSW 6 13836147 missense probably benign 0.42
R2343:Gpr85 UTSW 6 13836696 missense probably damaging 1.00
R3934:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3935:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3936:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R5313:Gpr85 UTSW 6 13836302 missense probably damaging 1.00
R5586:Gpr85 UTSW 6 13836001 nonsense probably null
R7043:Gpr85 UTSW 6 13835877 missense probably damaging 1.00
R8458:Gpr85 UTSW 6 13836849 missense probably benign
R8468:Gpr85 UTSW 6 13836296 missense probably damaging 1.00
R8503:Gpr85 UTSW 6 13836830 missense probably benign 0.01
R9519:Gpr85 UTSW 6 13836999 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTCCCTTGGTAACCTGG -3'
(R):5'- AACTGGACCTTTCATGGCCC -3'

Sequencing Primer
(F):5'- CCTGGATTTTCTGCAGTAAAGAAGG -3'
(R):5'- CTTTCATGGCCCTGGAGCTAG -3'
Posted On 2016-04-15