Incidental Mutation 'R4925:Tnpo2'
ID378964
Institutional Source Beutler Lab
Gene Symbol Tnpo2
Ensembl Gene ENSMUSG00000031691
Gene Nametransportin 2 (importin 3, karyopherin beta 2b)
SynonymsKpnb2b, TRN2, 1110034O24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4925 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85036915-85057583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85050025 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 454 (I454F)
Ref Sequence ENSEMBL: ENSMUSP00000147583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000166592] [ENSMUST00000211601]
Predicted Effect probably damaging
Transcript: ENSMUST00000093360
AA Change: I454F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691
AA Change: I454F

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156084
Predicted Effect probably damaging
Transcript: ENSMUST00000166592
AA Change: I454F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691
AA Change: I454F

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210576
Predicted Effect probably damaging
Transcript: ENSMUST00000211601
AA Change: I454F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Tnpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tnpo2 APN 8 85040526 missense probably damaging 0.98
IGL01843:Tnpo2 APN 8 85050508 missense probably damaging 0.99
IGL02475:Tnpo2 APN 8 85050502 missense probably benign 0.33
IGL02536:Tnpo2 APN 8 85045067 missense probably benign
IGL02644:Tnpo2 APN 8 85044480 missense possibly damaging 0.62
IGL02721:Tnpo2 APN 8 85054690 critical splice acceptor site probably null
IGL03155:Tnpo2 APN 8 85045080 missense probably benign 0.03
IGL03198:Tnpo2 APN 8 85051718 missense possibly damaging 0.75
R0127:Tnpo2 UTSW 8 85040628 missense probably damaging 1.00
R0456:Tnpo2 UTSW 8 85054416 missense probably damaging 1.00
R0505:Tnpo2 UTSW 8 85047362 missense probably benign 0.01
R0513:Tnpo2 UTSW 8 85053529 missense probably benign 0.00
R0531:Tnpo2 UTSW 8 85050157 missense probably damaging 1.00
R0595:Tnpo2 UTSW 8 85052041 nonsense probably null
R1113:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1308:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1851:Tnpo2 UTSW 8 85051772 missense probably damaging 1.00
R1965:Tnpo2 UTSW 8 85045317 critical splice donor site probably null
R2057:Tnpo2 UTSW 8 85050113 missense probably damaging 1.00
R2184:Tnpo2 UTSW 8 85053846 missense probably benign 0.35
R3801:Tnpo2 UTSW 8 85055171 splice site probably null
R3871:Tnpo2 UTSW 8 85054751 missense probably null 0.98
R4095:Tnpo2 UTSW 8 85038419 missense probably damaging 1.00
R4611:Tnpo2 UTSW 8 85053803 missense probably benign 0.38
R5744:Tnpo2 UTSW 8 85051894 nonsense probably null
R6107:Tnpo2 UTSW 8 85053475 missense probably damaging 1.00
R6581:Tnpo2 UTSW 8 85055404 missense probably damaging 1.00
R6586:Tnpo2 UTSW 8 85045202 missense possibly damaging 0.83
R7173:Tnpo2 UTSW 8 85055078 missense probably benign 0.05
R7196:Tnpo2 UTSW 8 85047137 missense possibly damaging 0.91
R7382:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7383:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7384:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7385:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7453:Tnpo2 UTSW 8 85055022 missense probably damaging 1.00
R7488:Tnpo2 UTSW 8 85055034 missense probably benign 0.03
R7638:Tnpo2 UTSW 8 85044415 missense probably benign 0.01
X0027:Tnpo2 UTSW 8 85044895 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TATTGGATATGCCCCAGCCTTC -3'
(R):5'- TGAGGGCCACCGTAAGAATG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CACCGTAAGAATGGGGGTC -3'
Posted On2016-04-15