Incidental Mutation 'R4925:Marveld3'
ID378966
Institutional Source Beutler Lab
Gene Symbol Marveld3
Ensembl Gene ENSMUSG00000001672
Gene NameMARVEL (membrane-associating) domain containing 3
Synonyms1810006A16Rik, MARVD3, Mrvldc3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4925 (G1)
Quality Score140
Status Not validated
Chromosome8
Chromosomal Location109947914-109962203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109948311 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000001722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001722] [ENSMUST00000034175] [ENSMUST00000051430] [ENSMUST00000179721]
Predicted Effect probably benign
Transcript: ENSMUST00000001722
AA Change: V291A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000001722
Gene: ENSMUSG00000001672
AA Change: V291A

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034175
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051430
SMART Domains Protein: ENSMUSP00000052309
Gene: ENSMUSG00000001672

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
Pfam:MARVEL 168 355 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179721
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Marveld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Marveld3 APN 8 109961964 missense possibly damaging 0.81
IGL01341:Marveld3 APN 8 109948417 missense possibly damaging 0.94
IGL01415:Marveld3 APN 8 109962073 missense possibly damaging 0.92
IGL01759:Marveld3 APN 8 109948087 missense possibly damaging 0.90
IGL02012:Marveld3 APN 8 109948132 missense probably damaging 0.99
R0732:Marveld3 UTSW 8 109948483 missense probably damaging 0.99
R1500:Marveld3 UTSW 8 109948542 unclassified probably null
R1955:Marveld3 UTSW 8 109959748 missense probably benign 0.08
R2146:Marveld3 UTSW 8 109959802 missense probably benign 0.00
R2172:Marveld3 UTSW 8 109961846 missense probably benign 0.22
R4843:Marveld3 UTSW 8 109962070 missense possibly damaging 0.66
R5542:Marveld3 UTSW 8 109948617 missense probably benign 0.03
R6003:Marveld3 UTSW 8 109954328 missense probably damaging 1.00
R6733:Marveld3 UTSW 8 109962049 missense possibly damaging 0.90
R6786:Marveld3 UTSW 8 109948100 missense probably benign 0.13
R7156:Marveld3 UTSW 8 109948188 missense probably damaging 1.00
R7194:Marveld3 UTSW 8 109959845 splice site probably null
R7429:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7430:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7810:Marveld3 UTSW 8 109954634 missense probably damaging 0.99
Z1088:Marveld3 UTSW 8 109948063 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGGCCGCGTATAAAATCAC -3'
(R):5'- GGCTTCGGAAATAACTATTACTCACC -3'

Sequencing Primer
(F):5'- CTGGCCGCGTATAAAATCACTAGAAG -3'
(R):5'- ACCGAGTTGGAGCAGGTTC -3'
Posted On2016-04-15