Incidental Mutation 'R4925:Trf'
ID 378969
Institutional Source Beutler Lab
Gene Symbol Trf
Ensembl Gene ENSMUSG00000032554
Gene Name transferrin
Synonyms HP, Tfn
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 103204001-103230444 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103219246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 25 (N25S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035158] [ENSMUST00000112645] [ENSMUST00000126359] [ENSMUST00000164377] [ENSMUST00000165296] [ENSMUST00000166836] [ENSMUST00000170904]
AlphaFold Q921I1
Predicted Effect probably benign
Transcript: ENSMUST00000035158
AA Change: N434S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035158
Gene: ENSMUSG00000032554
AA Change: N434S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112503
Predicted Effect probably benign
Transcript: ENSMUST00000112645
AA Change: N434S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108264
Gene: ENSMUSG00000032554
AA Change: N434S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126359
SMART Domains Protein: ENSMUSP00000120472
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 22 237 2.25e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164377
SMART Domains Protein: ENSMUSP00000128647
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Transferrin 25 72 6.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165296
SMART Domains Protein: ENSMUSP00000129013
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 171 5.58e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166836
AA Change: N420S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: N420S

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168142
AA Change: N25S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128609
Gene: ENSMUSG00000032554
AA Change: N25S

DomainStartEndE-ValueType
TR_FER 2 249 1.87e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170904
SMART Domains Protein: ENSMUSP00000128390
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 15 275 7.6e-139 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit refractory iron-deficient, hypochromic, microcytic anemia with iron-loading in the liver, pancreas, heart and brain. Mutants usually die by two weeks of age. Heterozygotes show minor increases in iron stores. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Trf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Trf APN 9 103220957 missense probably benign 0.00
IGL00424:Trf APN 9 103226936 missense probably damaging 1.00
IGL00793:Trf APN 9 103226143 unclassified probably benign
IGL01139:Trf APN 9 103223604 missense probably damaging 1.00
IGL01658:Trf APN 9 103226856 missense probably benign 0.04
IGL02671:Trf APN 9 103211982 missense probably benign 0.01
IGL02996:Trf APN 9 103220903 missense probably benign 0.01
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0112:Trf UTSW 9 103226956 unclassified probably benign
R0234:Trf UTSW 9 103226879 splice site probably null
R0234:Trf UTSW 9 103226879 splice site probably null
R0411:Trf UTSW 9 103217501 missense probably damaging 1.00
R0456:Trf UTSW 9 103226903 missense probably damaging 1.00
R0601:Trf UTSW 9 103222933 critical splice donor site probably null
R1419:Trf UTSW 9 103226108 missense probably damaging 1.00
R1606:Trf UTSW 9 103225136 splice site probably null
R3943:Trf UTSW 9 103222952 missense probably benign 0.00
R4431:Trf UTSW 9 103211876 missense possibly damaging 0.81
R4609:Trf UTSW 9 103211985 missense possibly damaging 0.81
R4658:Trf UTSW 9 103223608 missense probably damaging 1.00
R4830:Trf UTSW 9 103227915 missense probably damaging 0.98
R4929:Trf UTSW 9 103227875 intron probably benign
R4931:Trf UTSW 9 103228048 missense probably damaging 0.99
R5139:Trf UTSW 9 103222934 critical splice donor site probably null
R5272:Trf UTSW 9 103227978 missense probably damaging 1.00
R5692:Trf UTSW 9 103226125 missense possibly damaging 0.87
R6227:Trf UTSW 9 103230305 start gained probably benign
R6365:Trf UTSW 9 103222128 missense possibly damaging 0.70
R6928:Trf UTSW 9 103222108 missense possibly damaging 0.56
R7127:Trf UTSW 9 103225127 missense probably benign
R7231:Trf UTSW 9 103225148 missense probably damaging 1.00
R7648:Trf UTSW 9 103227969 missense probably benign 0.01
R8088:Trf UTSW 9 103211931 missense probably damaging 1.00
R8095:Trf UTSW 9 103210536 missense probably damaging 1.00
R8317:Trf UTSW 9 103217516 missense probably damaging 1.00
R8443:Trf UTSW 9 103217476 missense probably damaging 0.98
R8735:Trf UTSW 9 103210524 missense probably damaging 0.99
R8854:Trf UTSW 9 103230330 unclassified probably benign
R9131:Trf UTSW 9 103211888 missense probably damaging 0.99
R9360:Trf UTSW 9 103217535 critical splice acceptor site probably null
R9499:Trf UTSW 9 103222084 missense probably benign 0.00
R9526:Trf UTSW 9 103226931 missense probably damaging 1.00
R9551:Trf UTSW 9 103222084 missense probably benign 0.00
R9552:Trf UTSW 9 103222084 missense probably benign 0.00
R9710:Trf UTSW 9 103226018 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTAACCCTGTATCTGAGTCAC -3'
(R):5'- ATGAGTCCCAGAGGTCAACAG -3'

Sequencing Primer
(F):5'- GTAACCCTGTATCTGAGTCACCACAC -3'
(R):5'- GCCAGGTGAACTCTCAACATCTG -3'
Posted On 2016-04-15