Incidental Mutation 'R4925:Med23'
ID 378972
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms ESTM7, 3000002A17Rik, X83317, Sur2, Crsp3, sno
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 24745889-24789358 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24786645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 917 (F917S)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000020161] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000020159
AA Change: F1277S

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: F1277S

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020161
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: F1283S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: F1283S

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: F917S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: F917S

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184228
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,316,540 (GRCm39) C173* probably null Het
3425401B19Rik T A 14: 32,385,137 (GRCm39) H276L possibly damaging Het
Adam21 T G 12: 81,607,163 (GRCm39) M200L probably benign Het
Adamts3 A T 5: 89,832,182 (GRCm39) S974T probably benign Het
Adamtsl3 T A 7: 82,251,507 (GRCm39) probably null Het
Atp8b2 A G 3: 89,853,930 (GRCm39) probably null Het
Brd8 T C 18: 34,740,388 (GRCm39) T552A probably benign Het
Btaf1 A G 19: 36,988,733 (GRCm39) S1826G probably benign Het
Ccdc163 A G 4: 116,568,528 (GRCm39) E77G possibly damaging Het
Ces2g A G 8: 105,691,526 (GRCm39) R194G probably benign Het
Cip2a T C 16: 48,836,726 (GRCm39) probably null Het
Cln8 A G 8: 14,945,004 (GRCm39) H106R possibly damaging Het
Col12a1 T G 9: 79,582,077 (GRCm39) L1391F probably damaging Het
Col16a1 G A 4: 129,947,969 (GRCm39) D230N probably damaging Het
Crhbp C A 13: 95,580,318 (GRCm39) G87V possibly damaging Het
Cyp3a16 C T 5: 145,389,644 (GRCm39) M240I probably benign Het
Cyp4a14 A T 4: 115,353,133 (GRCm39) W60R possibly damaging Het
Fam47e A G 5: 92,733,149 (GRCm39) Y304C probably damaging Het
Fgfbp1 A T 5: 44,136,634 (GRCm39) D219E probably damaging Het
Fgfr2 A T 7: 129,787,002 (GRCm39) Y485N probably damaging Het
Fhdc1 C T 3: 84,360,840 (GRCm39) V363M probably damaging Het
Foxb1 T A 9: 69,667,437 (GRCm39) E31V probably damaging Het
Galnt9 T C 5: 110,692,605 (GRCm39) V13A possibly damaging Het
Ghrl T C 6: 113,693,218 (GRCm39) D77G probably damaging Het
Gpr85 A G 6: 13,835,977 (GRCm39) V309A probably benign Het
Greb1 T C 12: 16,731,472 (GRCm39) Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 (GRCm39) M1555K possibly damaging Het
Grin2a T A 16: 9,487,687 (GRCm39) N404Y probably damaging Het
Gtpbp1 A C 15: 79,600,169 (GRCm39) I399L probably benign Het
Hectd4 T C 5: 121,460,753 (GRCm39) S911P possibly damaging Het
Igkc A T 6: 70,703,520 (GRCm39) K34* probably null Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Iqgap1 T A 7: 80,415,065 (GRCm39) I149F probably damaging Het
Lama1 C T 17: 68,101,309 (GRCm39) A1934V probably benign Het
Lrp1 C A 10: 127,410,944 (GRCm39) E1415* probably null Het
Lypd8l T A 11: 58,501,513 (GRCm39) T157S probably damaging Het
Macf1 A C 4: 123,420,445 (GRCm39) C270G probably benign Het
Marveld3 A G 8: 110,674,943 (GRCm39) V291A probably benign Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Ncan A T 8: 70,562,604 (GRCm39) D551E probably benign Het
Or1e23 A T 11: 73,407,998 (GRCm39) I9N possibly damaging Het
Or4x6 T A 2: 89,949,121 (GRCm39) T274S probably damaging Het
Or52h2 T C 7: 103,839,387 (GRCm39) Y9C possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pla2g12a T C 3: 129,672,467 (GRCm39) W34R probably damaging Het
Plekha7 A G 7: 115,757,363 (GRCm39) F529S probably damaging Het
Potefam1 T C 2: 111,048,961 (GRCm39) K273E probably benign Het
Ppl T A 16: 4,922,846 (GRCm39) D215V probably damaging Het
Pramel15 A T 4: 144,104,502 (GRCm39) M1K probably null Het
Prdm1 T A 10: 44,316,165 (GRCm39) Y690F probably damaging Het
Prkcd T A 14: 30,329,570 (GRCm39) D124V probably damaging Het
Ptprc C A 1: 138,027,235 (GRCm39) D538Y probably benign Het
Rasl10b G A 11: 83,303,505 (GRCm39) V21M probably damaging Het
Rgsl1 T A 1: 153,688,023 (GRCm39) Y657F probably benign Het
Rrn3 T C 16: 13,617,836 (GRCm39) C360R probably damaging Het
Scarb1 T C 5: 125,374,363 (GRCm39) T257A probably damaging Het
Serpinb2 T A 1: 107,443,219 (GRCm39) M6K probably benign Het
Slco4a1 T C 2: 180,113,849 (GRCm39) Y429H probably benign Het
St13 G C 15: 81,283,786 (GRCm39) R4G probably benign Het
Taar3 T A 10: 23,826,441 (GRCm39) F329Y probably damaging Het
Tardbp A T 4: 148,703,108 (GRCm39) N285K probably benign Het
Tcstv7b A G 13: 120,702,384 (GRCm39) Y60C probably damaging Het
Tnni2 A T 7: 141,996,430 (GRCm39) E4V probably benign Het
Tnpo2 A T 8: 85,776,654 (GRCm39) I454F probably damaging Het
Tpr T G 1: 150,308,316 (GRCm39) H1690Q probably benign Het
Trav18 T C 14: 54,068,577 (GRCm39) S6P probably benign Het
Trf T C 9: 103,096,445 (GRCm39) N25S probably benign Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r2 T C 3: 64,044,892 (GRCm39) M1V probably null Het
Wdr64 T C 1: 175,552,268 (GRCm39) probably null Het
Wdr73 T C 7: 80,542,943 (GRCm39) S222G probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24,764,482 (GRCm39) missense probably damaging 1.00
IGL00792:Med23 APN 10 24,752,902 (GRCm39) missense possibly damaging 0.93
IGL01289:Med23 APN 10 24,778,019 (GRCm39) missense probably damaging 1.00
IGL01469:Med23 APN 10 24,758,495 (GRCm39) missense probably damaging 1.00
IGL01598:Med23 APN 10 24,779,696 (GRCm39) missense probably benign 0.34
IGL02324:Med23 APN 10 24,773,239 (GRCm39) missense probably damaging 0.98
IGL02381:Med23 APN 10 24,776,626 (GRCm39) missense possibly damaging 0.95
IGL02465:Med23 APN 10 24,779,641 (GRCm39) missense probably damaging 0.96
IGL02554:Med23 APN 10 24,774,473 (GRCm39) critical splice donor site probably null
IGL02683:Med23 APN 10 24,746,615 (GRCm39) missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R0080:Med23 UTSW 10 24,788,715 (GRCm39) missense probably benign 0.33
R0125:Med23 UTSW 10 24,776,686 (GRCm39) missense probably damaging 1.00
R0311:Med23 UTSW 10 24,773,256 (GRCm39) missense possibly damaging 0.95
R0765:Med23 UTSW 10 24,776,608 (GRCm39) missense probably damaging 1.00
R1302:Med23 UTSW 10 24,764,320 (GRCm39) splice site probably null
R1456:Med23 UTSW 10 24,779,550 (GRCm39) splice site probably benign
R1514:Med23 UTSW 10 24,768,565 (GRCm39) splice site probably benign
R1774:Med23 UTSW 10 24,779,584 (GRCm39) missense probably damaging 1.00
R1851:Med23 UTSW 10 24,786,768 (GRCm39) splice site probably null
R1928:Med23 UTSW 10 24,785,710 (GRCm39) missense probably benign
R1975:Med23 UTSW 10 24,786,664 (GRCm39) missense probably benign 0.01
R2011:Med23 UTSW 10 24,755,653 (GRCm39) missense possibly damaging 0.63
R2266:Med23 UTSW 10 24,750,499 (GRCm39) missense probably benign 0.00
R2309:Med23 UTSW 10 24,746,586 (GRCm39) missense probably damaging 0.99
R2507:Med23 UTSW 10 24,786,711 (GRCm39) missense probably damaging 1.00
R2566:Med23 UTSW 10 24,764,473 (GRCm39) missense probably damaging 1.00
R3720:Med23 UTSW 10 24,767,018 (GRCm39) missense probably damaging 1.00
R3771:Med23 UTSW 10 24,778,099 (GRCm39) missense probably damaging 1.00
R3811:Med23 UTSW 10 24,768,491 (GRCm39) splice site probably null
R3811:Med23 UTSW 10 24,768,490 (GRCm39) nonsense probably null
R4305:Med23 UTSW 10 24,780,168 (GRCm39) nonsense probably null
R4323:Med23 UTSW 10 24,746,603 (GRCm39) missense probably benign 0.02
R4701:Med23 UTSW 10 24,769,546 (GRCm39) missense probably damaging 1.00
R4886:Med23 UTSW 10 24,750,581 (GRCm39) critical splice donor site probably null
R4943:Med23 UTSW 10 24,751,567 (GRCm39) missense possibly damaging 0.92
R5207:Med23 UTSW 10 24,771,734 (GRCm39) nonsense probably null
R5749:Med23 UTSW 10 24,764,347 (GRCm39) missense possibly damaging 0.84
R5806:Med23 UTSW 10 24,783,119 (GRCm39) missense probably damaging 1.00
R5896:Med23 UTSW 10 24,778,043 (GRCm39) missense probably damaging 1.00
R5954:Med23 UTSW 10 24,746,381 (GRCm39) splice site probably benign
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6093:Med23 UTSW 10 24,754,341 (GRCm39) missense probably benign 0.16
R6107:Med23 UTSW 10 24,781,932 (GRCm39) nonsense probably null
R6356:Med23 UTSW 10 24,764,311 (GRCm39) missense probably damaging 0.98
R6393:Med23 UTSW 10 24,749,374 (GRCm39) missense possibly damaging 0.91
R6533:Med23 UTSW 10 24,769,518 (GRCm39) missense probably damaging 1.00
R6911:Med23 UTSW 10 24,778,079 (GRCm39) missense probably damaging 0.98
R6981:Med23 UTSW 10 24,771,722 (GRCm39) missense possibly damaging 0.92
R7085:Med23 UTSW 10 24,746,019 (GRCm39) missense probably damaging 1.00
R7215:Med23 UTSW 10 24,764,327 (GRCm39) missense probably benign
R7229:Med23 UTSW 10 24,777,902 (GRCm39) missense probably benign
R7489:Med23 UTSW 10 24,780,254 (GRCm39) missense probably damaging 1.00
R7530:Med23 UTSW 10 24,781,851 (GRCm39) missense probably benign 0.00
R7643:Med23 UTSW 10 24,781,863 (GRCm39) missense probably benign 0.01
R7653:Med23 UTSW 10 24,780,282 (GRCm39) missense probably damaging 1.00
R7764:Med23 UTSW 10 24,785,818 (GRCm39) critical splice donor site probably null
R7784:Med23 UTSW 10 24,778,346 (GRCm39) missense probably damaging 1.00
R8024:Med23 UTSW 10 24,755,581 (GRCm39) missense possibly damaging 0.74
R8182:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R8412:Med23 UTSW 10 24,784,632 (GRCm39) missense probably benign 0.01
R8874:Med23 UTSW 10 24,771,617 (GRCm39) missense possibly damaging 0.92
R8975:Med23 UTSW 10 24,780,334 (GRCm39) missense probably benign 0.42
R9131:Med23 UTSW 10 24,780,279 (GRCm39) missense
R9202:Med23 UTSW 10 24,780,202 (GRCm39) missense probably benign 0.12
R9341:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9342:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R9343:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9412:Med23 UTSW 10 24,778,019 (GRCm39) missense probably damaging 1.00
RF003:Med23 UTSW 10 24,779,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGAGTGCAGACTGTGTC -3'
(R):5'- CTGTGGCCTTAAGAGGTTAGATAC -3'

Sequencing Primer
(F):5'- CAGACTGTGTCCTATGTGCATAGC -3'
(R):5'- TGGCCTTAAGAGGTTAGATACTAGAC -3'
Posted On 2016-04-15