Incidental Mutation 'R4925:Olfr382'
ID378978
Institutional Source Beutler Lab
Gene Symbol Olfr382
Ensembl Gene ENSMUSG00000095312
Gene Nameolfactory receptor 382
SynonymsMOR135-31_p, MOR135-14, GA_x6K02T2P1NL-3676608-3675670
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4925 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73516259-73517197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73517172 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 9 (I9N)
Ref Sequence ENSEMBL: ENSMUSP00000091575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092921
AA Change: I9N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091575
Gene: ENSMUSG00000095312
AA Change: I9N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-10 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Olfr382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Olfr382 APN 11 73516410 missense possibly damaging 0.59
IGL00896:Olfr382 APN 11 73516341 missense probably damaging 1.00
IGL01723:Olfr382 APN 11 73516626 missense probably damaging 1.00
IGL01734:Olfr382 APN 11 73516636 missense probably benign 0.39
IGL02267:Olfr382 APN 11 73516549 missense probably benign 0.44
IGL02681:Olfr382 APN 11 73516530 missense probably benign
IGL03165:Olfr382 APN 11 73516884 nonsense probably null
BB009:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
BB019:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
IGL03134:Olfr382 UTSW 11 73517115 missense probably benign 0.02
R0320:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0633:Olfr382 UTSW 11 73516927 missense probably benign 0.23
R0638:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0691:Olfr382 UTSW 11 73516844 missense possibly damaging 0.55
R1630:Olfr382 UTSW 11 73516720 missense probably damaging 1.00
R2269:Olfr382 UTSW 11 73516483 missense probably damaging 1.00
R4001:Olfr382 UTSW 11 73516986 missense probably damaging 1.00
R5707:Olfr382 UTSW 11 73516625 missense probably damaging 1.00
R5911:Olfr382 UTSW 11 73516525 missense probably damaging 1.00
R6225:Olfr382 UTSW 11 73517005 missense probably damaging 0.99
R6251:Olfr382 UTSW 11 73516708 missense probably benign 0.00
R6332:Olfr382 UTSW 11 73517175 missense probably benign 0.00
R7013:Olfr382 UTSW 11 73516421 nonsense probably null
R7196:Olfr382 UTSW 11 73517131 missense probably benign
R7443:Olfr382 UTSW 11 73516848 missense possibly damaging 0.89
R7932:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
R8201:Olfr382 UTSW 11 73517073 missense probably damaging 1.00
R8257:Olfr382 UTSW 11 73516377 missense probably benign 0.28
R8547:Olfr382 UTSW 11 73516614 missense probably damaging 1.00
Z1177:Olfr382 UTSW 11 73517035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACTTGGGCATTGTGAC -3'
(R):5'- CAGGAACTTGGATGCCTGAG -3'

Sequencing Primer
(F):5'- CAACTTGGGCATTGTGACAGAGG -3'
(R):5'- CTTGAATTTTAAGGGACATGGA -3'
Posted On2016-04-15