Mutagenetix > Incidental Mutations

Incidental Mutation 'R4925:Greb1'

378980

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4925 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16681471 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1622 (Y1622C)

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048064
AA Change: Y1622C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Y1622C

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159120
AA Change: Y1594C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Y1594C

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160755

Predicted Effect

probably damaging
Transcript: ENSMUST00000162112
AA Change: Y1622C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Y1622C

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223113

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,425,714	C173*	probably null	Het
2210407C18Rik	T	A	11: 58,610,687	T157S	probably damaging	Het
3425401B19Rik	T	A	14: 32,663,180	H276L	possibly damaging	Het
4930430A15Rik	T	C	2: 111,218,616	K273E	probably benign	Het
Adam21	T	G	12: 81,560,389	M200L	probably benign	Het
Adamts3	A	T	5: 89,684,323	S974T	probably benign	Het
Adamtsl3	T	A	7: 82,602,299		probably null	Het
Atp8b2	A	G	3: 89,946,623		probably null	Het
Brd8	T	C	18: 34,607,335	T552A	probably benign	Het
Btaf1	A	G	19: 37,011,333	S1826G	probably benign	Het
C330027C09Rik	T	C	16: 49,016,363		probably null	Het
Ccdc163	A	G	4: 116,711,331	E77G	possibly damaging	Het
Ces2g	A	G	8: 104,964,894	R194G	probably benign	Het
Cln8	A	G	8: 14,895,004	H106R	possibly damaging	Het
Col12a1	T	G	9: 79,674,795	L1391F	probably damaging	Het
Col16a1	G	A	4: 130,054,176	D230N	probably damaging	Het
Crhbp	C	A	13: 95,443,810	G87V	possibly damaging	Het
Cyp3a16	C	T	5: 145,452,834	M240I	probably benign	Het
Cyp4a14	A	T	4: 115,495,936	W60R	possibly damaging	Het
Fam47e	A	G	5: 92,585,290	Y304C	probably damaging	Het
Fgfbp1	A	T	5: 43,979,292	D219E	probably damaging	Het
Fgfr2	A	T	7: 130,185,272	Y485N	probably damaging	Het
Fhdc1	C	T	3: 84,453,533	V363M	probably damaging	Het
Foxb1	T	A	9: 69,760,155	E31V	probably damaging	Het
Galnt9	T	C	5: 110,544,739	V13A	possibly damaging	Het
Ghrl	T	C	6: 113,716,257	D77G	probably damaging	Het
Gm21731	A	G	13: 120,240,848	Y60C	probably damaging	Het
Gpr85	A	G	6: 13,835,978	V309A	probably benign	Het
Greb1l	T	A	18: 10,547,447	M1555K	possibly damaging	Het
Grin2a	T	A	16: 9,669,823	N404Y	probably damaging	Het
Gtpbp1	A	C	15: 79,715,968	I399L	probably benign	Het
Hectd4	T	C	5: 121,322,690	S911P	possibly damaging	Het
Igkc	A	T	6: 70,726,536	K34*	probably null	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Iqgap1	T	A	7: 80,765,317	I149F	probably damaging	Het
Lama1	C	T	17: 67,794,314	A1934V	probably benign	Het
Lrp1	C	A	10: 127,575,075	E1415*	probably null	Het
Macf1	A	C	4: 123,526,652	C270G	probably benign	Het
Marveld3	A	G	8: 109,948,311	V291A	probably benign	Het
Med23	T	C	10: 24,910,747	F917S	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Ncan	A	T	8: 70,109,954	D551E	probably benign	Het
Olfr1269	T	A	2: 90,118,777	T274S	probably damaging	Het
Olfr382	A	T	11: 73,517,172	I9N	possibly damaging	Het
Olfr649	T	C	7: 104,190,180	Y9C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pla2g12a	T	C	3: 129,878,818	W34R	probably damaging	Het
Plekha7	A	G	7: 116,158,128	F529S	probably damaging	Het
Ppl	T	A	16: 5,104,982	D215V	probably damaging	Het
Pramef20	A	T	4: 144,377,932	M1K	probably null	Het
Prdm1	T	A	10: 44,440,169	Y690F	probably damaging	Het
Prkcd	T	A	14: 30,607,613	D124V	probably damaging	Het
Ptprc	C	A	1: 138,099,497	D538Y	probably benign	Het
Rasl10b	G	A	11: 83,412,679	V21M	probably damaging	Het
Rgsl1	T	A	1: 153,812,277	Y657F	probably benign	Het
Rrn3	T	C	16: 13,799,972	C360R	probably damaging	Het
Scarb1	T	C	5: 125,297,299	T257A	probably damaging	Het
Serpinb2	T	A	1: 107,515,489	M6K	probably benign	Het
Slco4a1	T	C	2: 180,472,056	Y429H	probably benign	Het
St13	G	C	15: 81,399,585	R4G	probably benign	Het
Taar3	T	A	10: 23,950,543	F329Y	probably damaging	Het
Tardbp	A	T	4: 148,618,651	N285K	probably benign	Het
Tnni2	A	T	7: 142,442,693	E4V	probably benign	Het
Tnpo2	A	T	8: 85,050,025	I454F	probably damaging	Het
Tpr	T	G	1: 150,432,565	H1690Q	probably benign	Het
Trav18	T	C	14: 53,831,120	S6P	probably benign	Het
Trf	T	C	9: 103,219,246	N25S	probably benign	Het
Vmn1r59	T	C	7: 5,454,116	N215S	probably benign	Het
Vmn2r2	T	C	3: 64,137,471	M1V	probably null	Het
Wdr64	T	C	1: 175,724,702		probably null	Het
Wdr73	T	C	7: 80,893,195	S222G	probably benign	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCCTGTCACGAGAGGCAC -3'
(R):5'- AACTAATTTCCCCAGCTGTCAG -3'

Sequencing Primer
(F):5'- TGTCACGAGAGGCACACTGTG -3'
(R):5'- TTTCCCCAGCTGTCAGAAAAAG -3'

Posted On

2016-04-15