Incidental Mutation 'R4925:Greb1'
ID378980
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4925 (G1)
Quality Score217
Status Not validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16681471 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1622 (Y1622C)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: Y1622C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Y1622C

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159120
AA Change: Y1594C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Y1594C

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160755
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: Y1622C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Y1622C

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223113
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCTGTCACGAGAGGCAC -3'
(R):5'- AACTAATTTCCCCAGCTGTCAG -3'

Sequencing Primer
(F):5'- TGTCACGAGAGGCACACTGTG -3'
(R):5'- TTTCCCCAGCTGTCAGAAAAAG -3'
Posted On2016-04-15