Incidental Mutation 'R4925:Adam21'
ID 378981
Institutional Source Beutler Lab
Gene Symbol Adam21
Ensembl Gene ENSMUSG00000008438
Gene Name a disintegrin and metallopeptidase domain 21
Synonyms ADAM31
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 81558584-81568474 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 81560389 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 200 (M200L)
Ref Sequence ENSEMBL: ENSMUSP00000008582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008582]
AlphaFold Q9JI76
Predicted Effect probably benign
Transcript: ENSMUST00000008582
AA Change: M200L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000008582
Gene: ENSMUSG00000008438
AA Change: M200L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 164 5.1e-21 PFAM
Pfam:Reprolysin_4 212 389 2.5e-11 PFAM
Pfam:Reprolysin 212 402 7.3e-50 PFAM
Pfam:Reprolysin_5 214 400 5.8e-19 PFAM
Pfam:Reprolysin_2 233 393 1.3e-14 PFAM
Pfam:Reprolysin_3 236 356 6.5e-16 PFAM
DISIN 419 494 2.45e-37 SMART
ACR 495 631 6.49e-62 SMART
EGF 637 667 2.03e1 SMART
transmembrane domain 687 709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166971
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. The encoded protein functions in the regulation of spermatogenesis in the testes and neurogenesis in the central nervous system. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Adam21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Adam21 APN 12 81559209 missense possibly damaging 0.61
IGL02311:Adam21 APN 12 81560892 missense probably benign 0.01
IGL03132:Adam21 APN 12 81560374 nonsense probably null
IGL03225:Adam21 APN 12 81559269 missense probably benign 0.00
BB009:Adam21 UTSW 12 81560164 missense probably damaging 0.98
BB019:Adam21 UTSW 12 81560164 missense probably damaging 0.98
R0305:Adam21 UTSW 12 81560285 missense possibly damaging 0.96
R0634:Adam21 UTSW 12 81560352 missense probably benign 0.01
R1415:Adam21 UTSW 12 81559547 nonsense probably null
R1961:Adam21 UTSW 12 81559508 nonsense probably null
R1996:Adam21 UTSW 12 81559602 missense possibly damaging 0.79
R2159:Adam21 UTSW 12 81560467 missense probably benign 0.17
R2215:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R3780:Adam21 UTSW 12 81559273 missense probably damaging 1.00
R3964:Adam21 UTSW 12 81560809 missense possibly damaging 0.46
R4356:Adam21 UTSW 12 81558820 missense probably damaging 0.99
R4503:Adam21 UTSW 12 81560898 missense probably benign
R4795:Adam21 UTSW 12 81560974 missense probably benign 0.06
R4932:Adam21 UTSW 12 81558918 missense probably benign 0.14
R5110:Adam21 UTSW 12 81560215 missense probably benign 0.40
R5831:Adam21 UTSW 12 81559101 missense probably benign 0.06
R6289:Adam21 UTSW 12 81560706 missense probably damaging 1.00
R6500:Adam21 UTSW 12 81559606 missense probably benign 0.01
R7077:Adam21 UTSW 12 81559119 missense probably damaging 1.00
R7083:Adam21 UTSW 12 81560241 missense possibly damaging 0.81
R7173:Adam21 UTSW 12 81559234 missense probably benign 0.24
R7176:Adam21 UTSW 12 81560248 missense possibly damaging 0.94
R7232:Adam21 UTSW 12 81560556 missense probably damaging 0.99
R7371:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R7486:Adam21 UTSW 12 81558883 missense probably benign 0.00
R7522:Adam21 UTSW 12 81558948 missense possibly damaging 0.78
R7918:Adam21 UTSW 12 81560604 missense possibly damaging 0.64
R7932:Adam21 UTSW 12 81560164 missense probably damaging 0.98
R8040:Adam21 UTSW 12 81560437 missense probably benign 0.04
R8486:Adam21 UTSW 12 81560776 missense probably benign 0.08
R8750:Adam21 UTSW 12 81560473 nonsense probably null
R8881:Adam21 UTSW 12 81559876 missense probably benign 0.02
R9084:Adam21 UTSW 12 81559386 missense probably damaging 1.00
R9541:Adam21 UTSW 12 81560950 missense probably benign
R9564:Adam21 UTSW 12 81559059 missense probably damaging 1.00
Z1088:Adam21 UTSW 12 81560686 missense probably damaging 1.00
Z1176:Adam21 UTSW 12 81559743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAAGTATCCAGCGGCTTG -3'
(R):5'- GGGAGCCCTTGAGTCTTTAG -3'

Sequencing Primer
(F):5'- CAGCGGCTTGTACATGGAATCTAC -3'
(R):5'- GGAGTGTTACAAATGAATGGCTTCTC -3'
Posted On 2016-04-15