Incidental Mutation 'R4925:Prkcd'
ID 378984
Institutional Source Beutler Lab
Gene Symbol Prkcd
Ensembl Gene ENSMUSG00000021948
Gene Name protein kinase C, delta
Synonyms PKC[d], D14Ertd420e, Pkcd, PKCdelta
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R4925 (G1)
Quality Score 151
Status Not validated
Chromosome 14
Chromosomal Location 30317311-30348167 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30329570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 124 (D124V)
Ref Sequence ENSEMBL: ENSMUSP00000107830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022521] [ENSMUST00000112202] [ENSMUST00000112203] [ENSMUST00000112206] [ENSMUST00000112207] [ENSMUST00000112210] [ENSMUST00000112211]
AlphaFold P28867
Predicted Effect probably damaging
Transcript: ENSMUST00000022521
AA Change: D124V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022521
Gene: ENSMUSG00000021948
AA Change: D124V

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112202
AA Change: D9V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107821
Gene: ENSMUSG00000021948
AA Change: D9V

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112203
AA Change: D9V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107822
Gene: ENSMUSG00000021948
AA Change: D9V

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112206
AA Change: D9V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107825
Gene: ENSMUSG00000021948
AA Change: D9V

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
S_TK_X 513 576 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112207
AA Change: D9V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107826
Gene: ENSMUSG00000021948
AA Change: D9V

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
S_TK_X 487 550 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112208
SMART Domains Protein: ENSMUSP00000107827
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112210
AA Change: D124V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107829
Gene: ENSMUSG00000021948
AA Change: D124V

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112211
AA Change: D124V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107830
Gene: ENSMUSG00000021948
AA Change: D124V

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227078
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,316,540 (GRCm39) C173* probably null Het
3425401B19Rik T A 14: 32,385,137 (GRCm39) H276L possibly damaging Het
Adam21 T G 12: 81,607,163 (GRCm39) M200L probably benign Het
Adamts3 A T 5: 89,832,182 (GRCm39) S974T probably benign Het
Adamtsl3 T A 7: 82,251,507 (GRCm39) probably null Het
Atp8b2 A G 3: 89,853,930 (GRCm39) probably null Het
Brd8 T C 18: 34,740,388 (GRCm39) T552A probably benign Het
Btaf1 A G 19: 36,988,733 (GRCm39) S1826G probably benign Het
Ccdc163 A G 4: 116,568,528 (GRCm39) E77G possibly damaging Het
Ces2g A G 8: 105,691,526 (GRCm39) R194G probably benign Het
Cip2a T C 16: 48,836,726 (GRCm39) probably null Het
Cln8 A G 8: 14,945,004 (GRCm39) H106R possibly damaging Het
Col12a1 T G 9: 79,582,077 (GRCm39) L1391F probably damaging Het
Col16a1 G A 4: 129,947,969 (GRCm39) D230N probably damaging Het
Crhbp C A 13: 95,580,318 (GRCm39) G87V possibly damaging Het
Cyp3a16 C T 5: 145,389,644 (GRCm39) M240I probably benign Het
Cyp4a14 A T 4: 115,353,133 (GRCm39) W60R possibly damaging Het
Fam47e A G 5: 92,733,149 (GRCm39) Y304C probably damaging Het
Fgfbp1 A T 5: 44,136,634 (GRCm39) D219E probably damaging Het
Fgfr2 A T 7: 129,787,002 (GRCm39) Y485N probably damaging Het
Fhdc1 C T 3: 84,360,840 (GRCm39) V363M probably damaging Het
Foxb1 T A 9: 69,667,437 (GRCm39) E31V probably damaging Het
Galnt9 T C 5: 110,692,605 (GRCm39) V13A possibly damaging Het
Ghrl T C 6: 113,693,218 (GRCm39) D77G probably damaging Het
Gpr85 A G 6: 13,835,977 (GRCm39) V309A probably benign Het
Greb1 T C 12: 16,731,472 (GRCm39) Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 (GRCm39) M1555K possibly damaging Het
Grin2a T A 16: 9,487,687 (GRCm39) N404Y probably damaging Het
Gtpbp1 A C 15: 79,600,169 (GRCm39) I399L probably benign Het
Hectd4 T C 5: 121,460,753 (GRCm39) S911P possibly damaging Het
Igkc A T 6: 70,703,520 (GRCm39) K34* probably null Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Iqgap1 T A 7: 80,415,065 (GRCm39) I149F probably damaging Het
Lama1 C T 17: 68,101,309 (GRCm39) A1934V probably benign Het
Lrp1 C A 10: 127,410,944 (GRCm39) E1415* probably null Het
Lypd8l T A 11: 58,501,513 (GRCm39) T157S probably damaging Het
Macf1 A C 4: 123,420,445 (GRCm39) C270G probably benign Het
Marveld3 A G 8: 110,674,943 (GRCm39) V291A probably benign Het
Med23 T C 10: 24,786,645 (GRCm39) F917S probably damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Ncan A T 8: 70,562,604 (GRCm39) D551E probably benign Het
Or1e23 A T 11: 73,407,998 (GRCm39) I9N possibly damaging Het
Or4x6 T A 2: 89,949,121 (GRCm39) T274S probably damaging Het
Or52h2 T C 7: 103,839,387 (GRCm39) Y9C possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pla2g12a T C 3: 129,672,467 (GRCm39) W34R probably damaging Het
Plekha7 A G 7: 115,757,363 (GRCm39) F529S probably damaging Het
Potefam1 T C 2: 111,048,961 (GRCm39) K273E probably benign Het
Ppl T A 16: 4,922,846 (GRCm39) D215V probably damaging Het
Pramel15 A T 4: 144,104,502 (GRCm39) M1K probably null Het
Prdm1 T A 10: 44,316,165 (GRCm39) Y690F probably damaging Het
Ptprc C A 1: 138,027,235 (GRCm39) D538Y probably benign Het
Rasl10b G A 11: 83,303,505 (GRCm39) V21M probably damaging Het
Rgsl1 T A 1: 153,688,023 (GRCm39) Y657F probably benign Het
Rrn3 T C 16: 13,617,836 (GRCm39) C360R probably damaging Het
Scarb1 T C 5: 125,374,363 (GRCm39) T257A probably damaging Het
Serpinb2 T A 1: 107,443,219 (GRCm39) M6K probably benign Het
Slco4a1 T C 2: 180,113,849 (GRCm39) Y429H probably benign Het
St13 G C 15: 81,283,786 (GRCm39) R4G probably benign Het
Taar3 T A 10: 23,826,441 (GRCm39) F329Y probably damaging Het
Tardbp A T 4: 148,703,108 (GRCm39) N285K probably benign Het
Tcstv7b A G 13: 120,702,384 (GRCm39) Y60C probably damaging Het
Tnni2 A T 7: 141,996,430 (GRCm39) E4V probably benign Het
Tnpo2 A T 8: 85,776,654 (GRCm39) I454F probably damaging Het
Tpr T G 1: 150,308,316 (GRCm39) H1690Q probably benign Het
Trav18 T C 14: 54,068,577 (GRCm39) S6P probably benign Het
Trf T C 9: 103,096,445 (GRCm39) N25S probably benign Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r2 T C 3: 64,044,892 (GRCm39) M1V probably null Het
Wdr64 T C 1: 175,552,268 (GRCm39) probably null Het
Wdr73 T C 7: 80,542,943 (GRCm39) S222G probably benign Het
Other mutations in Prkcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Prkcd APN 14 30,324,379 (GRCm39) splice site probably benign
IGL00715:Prkcd APN 14 30,317,960 (GRCm39) missense probably damaging 1.00
IGL01914:Prkcd APN 14 30,329,383 (GRCm39) missense possibly damaging 0.49
IGL02177:Prkcd APN 14 30,327,844 (GRCm39) missense probably damaging 1.00
IGL02547:Prkcd APN 14 30,321,426 (GRCm39) missense probably damaging 1.00
IGL02681:Prkcd APN 14 30,323,190 (GRCm39) critical splice acceptor site probably null
Rigged UTSW 14 30,332,258 (GRCm39) start codon destroyed probably null 0.99
rigged2 UTSW 14 30,321,700 (GRCm39) missense probably damaging 1.00
IGL03014:Prkcd UTSW 14 30,329,294 (GRCm39) missense probably damaging 1.00
R0240:Prkcd UTSW 14 30,324,045 (GRCm39) missense probably damaging 0.97
R0240:Prkcd UTSW 14 30,324,045 (GRCm39) missense probably damaging 0.97
R1385:Prkcd UTSW 14 30,329,362 (GRCm39) missense probably damaging 1.00
R1567:Prkcd UTSW 14 30,329,405 (GRCm39) missense probably benign 0.35
R2114:Prkcd UTSW 14 30,327,808 (GRCm39) missense probably damaging 1.00
R2983:Prkcd UTSW 14 30,321,435 (GRCm39) missense probably damaging 1.00
R3716:Prkcd UTSW 14 30,321,669 (GRCm39) missense probably benign 0.00
R4162:Prkcd UTSW 14 30,323,154 (GRCm39) missense probably damaging 0.98
R4164:Prkcd UTSW 14 30,323,154 (GRCm39) missense probably damaging 0.98
R4180:Prkcd UTSW 14 30,332,261 (GRCm39) utr 5 prime probably benign
R4637:Prkcd UTSW 14 30,320,722 (GRCm39) missense probably benign 0.00
R4750:Prkcd UTSW 14 30,332,258 (GRCm39) start codon destroyed probably null 0.99
R4756:Prkcd UTSW 14 30,321,623 (GRCm39) missense probably benign 0.00
R4849:Prkcd UTSW 14 30,321,700 (GRCm39) missense probably damaging 1.00
R4850:Prkcd UTSW 14 30,321,700 (GRCm39) missense probably damaging 1.00
R4893:Prkcd UTSW 14 30,321,382 (GRCm39) missense probably damaging 1.00
R4914:Prkcd UTSW 14 30,327,395 (GRCm39) critical splice donor site probably null
R5644:Prkcd UTSW 14 30,329,370 (GRCm39) missense probably benign 0.06
R5832:Prkcd UTSW 14 30,327,778 (GRCm39) missense probably damaging 0.99
R5910:Prkcd UTSW 14 30,317,938 (GRCm39) missense probably benign 0.01
R6049:Prkcd UTSW 14 30,329,254 (GRCm39) missense possibly damaging 0.95
R6322:Prkcd UTSW 14 30,321,620 (GRCm39) missense probably damaging 1.00
R7177:Prkcd UTSW 14 30,321,664 (GRCm39) missense probably damaging 1.00
R7358:Prkcd UTSW 14 30,327,793 (GRCm39) missense probably benign
R7494:Prkcd UTSW 14 30,331,150 (GRCm39) missense probably benign 0.00
R7554:Prkcd UTSW 14 30,331,220 (GRCm39) missense probably damaging 0.96
R7778:Prkcd UTSW 14 30,327,772 (GRCm39) critical splice donor site probably null
R7810:Prkcd UTSW 14 30,320,407 (GRCm39) splice site probably null
R8020:Prkcd UTSW 14 30,331,201 (GRCm39) missense possibly damaging 0.58
R8145:Prkcd UTSW 14 30,324,019 (GRCm39) missense probably benign 0.03
R8417:Prkcd UTSW 14 30,331,208 (GRCm39) missense probably benign 0.36
R9009:Prkcd UTSW 14 30,329,297 (GRCm39) missense probably damaging 0.99
R9246:Prkcd UTSW 14 30,327,432 (GRCm39) missense probably damaging 1.00
R9528:Prkcd UTSW 14 30,323,768 (GRCm39) missense probably damaging 1.00
R9748:Prkcd UTSW 14 30,320,800 (GRCm39) missense possibly damaging 0.87
R9783:Prkcd UTSW 14 30,321,444 (GRCm39) missense probably damaging 0.99
Z1176:Prkcd UTSW 14 30,332,206 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTAATGGCTCCACGACGGTTC -3'
(R):5'- AGTCTGAACTGGCTCTAGGG -3'

Sequencing Primer
(F):5'- CACTACGCATAGACTGTTTGCAATC -3'
(R):5'- GGCCCTCACTGATTTGTC -3'
Posted On 2016-04-15