Incidental Mutation 'R4925:Mfng'
ID 378988
Institutional Source Beutler Lab
Gene Symbol Mfng
Ensembl Gene ENSMUSG00000018169
Gene Name MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonyms manic fringe
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock # R4925 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78755882-78773475 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78764388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 163 (R163H)
Ref Sequence ENSEMBL: ENSMUSP00000018313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313]
AlphaFold O09008
PDB Structure STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE [X-RAY DIFFRACTION]
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE IN COMPLEX WITH UDP AND MANGANESE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000018313
AA Change: R163H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169
AA Change: R163H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136795
Meta Mutation Damage Score 0.1111 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit normal pancreatic development, morphology and physiology. Mice homozygous for a different knock-out allele exhibit altered lymphocyte numbers, abnormal circulating factors II, VII, IX and XI, and decreased prothrombin and partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Mfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mfng UTSW 15 78764437 missense possibly damaging 0.79
R0504:Mfng UTSW 15 78757314 missense probably benign 0.00
R1905:Mfng UTSW 15 78773086 missense probably damaging 1.00
R3871:Mfng UTSW 15 78756621 missense probably damaging 1.00
R4845:Mfng UTSW 15 78764388 missense probably benign
R4872:Mfng UTSW 15 78764388 missense probably benign
R4874:Mfng UTSW 15 78764388 missense probably benign
R4934:Mfng UTSW 15 78764388 missense probably benign
R5006:Mfng UTSW 15 78764388 missense probably benign
R5029:Mfng UTSW 15 78764388 missense probably benign
R5048:Mfng UTSW 15 78764388 missense probably benign
R5064:Mfng UTSW 15 78764388 missense probably benign
R5067:Mfng UTSW 15 78764388 missense probably benign
R5143:Mfng UTSW 15 78764388 missense probably benign
R5145:Mfng UTSW 15 78764388 missense probably benign
R5146:Mfng UTSW 15 78764388 missense probably benign
R5266:Mfng UTSW 15 78764388 missense probably benign
R5969:Mfng UTSW 15 78764382 missense possibly damaging 0.94
R6012:Mfng UTSW 15 78756640 missense probably damaging 1.00
R6654:Mfng UTSW 15 78759339 missense probably damaging 1.00
R7211:Mfng UTSW 15 78773068 missense probably benign 0.12
R7793:Mfng UTSW 15 78773065 missense probably damaging 1.00
R8292:Mfng UTSW 15 78773170 missense probably benign
R9021:Mfng UTSW 15 78773148 missense probably benign 0.06
R9289:Mfng UTSW 15 78759257 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCCATGGTGATTCTAGGTGGCTAG -3'
(R):5'- CTCCCTGACTCACAGCTATTAG -3'

Sequencing Primer
(F):5'- CAAGACAGGGCTCTCTGATG -3'
(R):5'- CTATTAGCTGTTGACCTCGGGGAC -3'
Posted On 2016-04-15