Incidental Mutation 'R4925:St13'
ID 378990
Institutional Source Beutler Lab
Gene Symbol St13
Ensembl Gene ENSMUSG00000022403
Gene Name suppression of tumorigenicity 13
Synonyms Hsp70 interacting protein, HSPABP1, PRO0786, 1110007I03Rik, 3110002K08Rik, SNC6, p48
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R4925 (G1)
Quality Score 126
Status Not validated
Chromosome 15
Chromosomal Location 81363669-81400077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 81399585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 4 (R4G)
Ref Sequence ENSEMBL: ENSMUSP00000131502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023039] [ENSMUST00000041609] [ENSMUST00000163382] [ENSMUST00000163754] [ENSMUST00000165258] [ENSMUST00000165582] [ENSMUST00000167799] [ENSMUST00000169204] [ENSMUST00000172107]
AlphaFold Q99L47
Predicted Effect probably benign
Transcript: ENSMUST00000023039
AA Change: R4G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023039
Gene: ENSMUSG00000022403
AA Change: R4G

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 72 N/A INTRINSIC
TPR 104 137 1.2e1 SMART
TPR 138 171 6.95e-4 SMART
TPR 172 205 4.8e1 SMART
coiled coil region 225 264 N/A INTRINSIC
low complexity region 271 305 N/A INTRINSIC
STI1 312 351 3.37e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041609
SMART Domains Protein: ENSMUSP00000038331
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 366 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163296
Predicted Effect probably benign
Transcript: ENSMUST00000163382
AA Change: R4G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131502
Gene: ENSMUSG00000022403
AA Change: R4G

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 2e-27 PDB
low complexity region 52 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163754
SMART Domains Protein: ENSMUSP00000132822
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 481 1.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164144
Predicted Effect probably benign
Transcript: ENSMUST00000165258
Predicted Effect probably benign
Transcript: ENSMUST00000165582
SMART Domains Protein: ENSMUSP00000129966
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
Pfam:TPR_11 74 129 6.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167799
SMART Domains Protein: ENSMUSP00000126038
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 203 6.87e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169204
Predicted Effect probably benign
Transcript: ENSMUST00000172107
AA Change: R4G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130195
Gene: ENSMUSG00000022403
AA Change: R4G

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 66 N/A INTRINSIC
low complexity region 71 81 N/A INTRINSIC
TPR 113 146 1.2e1 SMART
TPR 147 180 6.95e-4 SMART
TPR 181 214 4.8e1 SMART
coiled coil region 234 273 N/A INTRINSIC
low complexity region 280 314 N/A INTRINSIC
STI1 321 360 3.37e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230906
Meta Mutation Damage Score 0.1302 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adaptor protein that mediates the association of the heat shock proteins HSP70 and HSP90. This protein has been shown to be involved in the assembly process of glucocorticoid receptor, which requires the assistance of multiple molecular chaperones. The expression of this gene is reported to be downregulated in colorectal carcinoma tissue suggesting that it is a candidate tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in St13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:St13 APN 15 81371507 missense probably damaging 0.99
IGL01933:St13 APN 15 81389698 critical splice acceptor site probably null
IGL02152:St13 APN 15 81366382 missense probably damaging 1.00
R0714:St13 UTSW 15 81383027 missense probably benign 0.16
R3417:St13 UTSW 15 81369450 splice site probably benign
R4845:St13 UTSW 15 81399585 missense probably benign 0.09
R4934:St13 UTSW 15 81399585 missense probably benign 0.09
R5029:St13 UTSW 15 81399585 missense probably benign 0.09
R5042:St13 UTSW 15 81365492 missense probably damaging 1.00
R5048:St13 UTSW 15 81399585 missense probably benign 0.09
R5139:St13 UTSW 15 81399585 missense probably benign 0.09
R5970:St13 UTSW 15 81377798 missense probably damaging 0.99
R6158:St13 UTSW 15 81399601 splice site probably null
R6175:St13 UTSW 15 81399305 critical splice donor site probably null
R6872:St13 UTSW 15 81366346 critical splice donor site probably null
R7320:St13 UTSW 15 81389653 missense probably damaging 0.99
R7912:St13 UTSW 15 81399518 missense possibly damaging 0.52
R9258:St13 UTSW 15 81388368 missense probably benign 0.01
R9281:St13 UTSW 15 81377726 missense probably damaging 0.99
R9442:St13 UTSW 15 81388374 missense possibly damaging 0.88
R9483:St13 UTSW 15 81366386 missense probably damaging 0.99
R9549:St13 UTSW 15 81374862 missense possibly damaging 0.64
X0065:St13 UTSW 15 81366436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCGAAGCCACTAAGAGCC -3'
(R):5'- GCAGCTACACTTCTAGAAGGTTC -3'

Sequencing Primer
(F):5'- CACGAAGGGGCCTAGAACC -3'
(R):5'- TAGAAGGTTCTAGGCGGAGC -3'
Posted On 2016-04-15