Mutagenetix > Incidental Mutation

Incidental Mutation 'R4925:Grin2a'

378992

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

R4925 (G1)

Quality Score

224

Status

Not validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9669823 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 404 (N404Y)

Ref Sequence

ENSEMBL: ENSMUSP00000142900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

probably damaging
Transcript: ENSMUST00000032331
AA Change: N404Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: N404Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115835
AA Change: N404Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: N404Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199708
AA Change: N404Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: N404Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,425,714	C173*	probably null	Het
2210407C18Rik	T	A	11: 58,610,687	T157S	probably damaging	Het
3425401B19Rik	T	A	14: 32,663,180	H276L	possibly damaging	Het
4930430A15Rik	T	C	2: 111,218,616	K273E	probably benign	Het
Adam21	T	G	12: 81,560,389	M200L	probably benign	Het
Adamts3	A	T	5: 89,684,323	S974T	probably benign	Het
Adamtsl3	T	A	7: 82,602,299		probably null	Het
Atp8b2	A	G	3: 89,946,623		probably null	Het
Brd8	T	C	18: 34,607,335	T552A	probably benign	Het
Btaf1	A	G	19: 37,011,333	S1826G	probably benign	Het
C330027C09Rik	T	C	16: 49,016,363		probably null	Het
Ccdc163	A	G	4: 116,711,331	E77G	possibly damaging	Het
Ces2g	A	G	8: 104,964,894	R194G	probably benign	Het
Cln8	A	G	8: 14,895,004	H106R	possibly damaging	Het
Col12a1	T	G	9: 79,674,795	L1391F	probably damaging	Het
Col16a1	G	A	4: 130,054,176	D230N	probably damaging	Het
Crhbp	C	A	13: 95,443,810	G87V	possibly damaging	Het
Cyp3a16	C	T	5: 145,452,834	M240I	probably benign	Het
Cyp4a14	A	T	4: 115,495,936	W60R	possibly damaging	Het
Fam47e	A	G	5: 92,585,290	Y304C	probably damaging	Het
Fgfbp1	A	T	5: 43,979,292	D219E	probably damaging	Het
Fgfr2	A	T	7: 130,185,272	Y485N	probably damaging	Het
Fhdc1	C	T	3: 84,453,533	V363M	probably damaging	Het
Foxb1	T	A	9: 69,760,155	E31V	probably damaging	Het
Galnt9	T	C	5: 110,544,739	V13A	possibly damaging	Het
Ghrl	T	C	6: 113,716,257	D77G	probably damaging	Het
Gm21731	A	G	13: 120,240,848	Y60C	probably damaging	Het
Gpr85	A	G	6: 13,835,978	V309A	probably benign	Het
Greb1	T	C	12: 16,681,471	Y1622C	probably damaging	Het
Greb1l	T	A	18: 10,547,447	M1555K	possibly damaging	Het
Gtpbp1	A	C	15: 79,715,968	I399L	probably benign	Het
Hectd4	T	C	5: 121,322,690	S911P	possibly damaging	Het
Igkc	A	T	6: 70,726,536	K34*	probably null	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Iqgap1	T	A	7: 80,765,317	I149F	probably damaging	Het
Lama1	C	T	17: 67,794,314	A1934V	probably benign	Het
Lrp1	C	A	10: 127,575,075	E1415*	probably null	Het
Macf1	A	C	4: 123,526,652	C270G	probably benign	Het
Marveld3	A	G	8: 109,948,311	V291A	probably benign	Het
Med23	T	C	10: 24,910,747	F917S	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Ncan	A	T	8: 70,109,954	D551E	probably benign	Het
Olfr1269	T	A	2: 90,118,777	T274S	probably damaging	Het
Olfr382	A	T	11: 73,517,172	I9N	possibly damaging	Het
Olfr649	T	C	7: 104,190,180	Y9C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pla2g12a	T	C	3: 129,878,818	W34R	probably damaging	Het
Plekha7	A	G	7: 116,158,128	F529S	probably damaging	Het
Ppl	T	A	16: 5,104,982	D215V	probably damaging	Het
Pramef20	A	T	4: 144,377,932	M1K	probably null	Het
Prdm1	T	A	10: 44,440,169	Y690F	probably damaging	Het
Prkcd	T	A	14: 30,607,613	D124V	probably damaging	Het
Ptprc	C	A	1: 138,099,497	D538Y	probably benign	Het
Rasl10b	G	A	11: 83,412,679	V21M	probably damaging	Het
Rgsl1	T	A	1: 153,812,277	Y657F	probably benign	Het
Rrn3	T	C	16: 13,799,972	C360R	probably damaging	Het
Scarb1	T	C	5: 125,297,299	T257A	probably damaging	Het
Serpinb2	T	A	1: 107,515,489	M6K	probably benign	Het
Slco4a1	T	C	2: 180,472,056	Y429H	probably benign	Het
St13	G	C	15: 81,399,585	R4G	probably benign	Het
Taar3	T	A	10: 23,950,543	F329Y	probably damaging	Het
Tardbp	A	T	4: 148,618,651	N285K	probably benign	Het
Tnni2	A	T	7: 142,442,693	E4V	probably benign	Het
Tnpo2	A	T	8: 85,050,025	I454F	probably damaging	Het
Tpr	T	G	1: 150,432,565	H1690Q	probably benign	Het
Trav18	T	C	14: 53,831,120	S6P	probably benign	Het
Trf	T	C	9: 103,219,246	N25S	probably benign	Het
Vmn1r59	T	C	7: 5,454,116	N215S	probably benign	Het
Vmn2r2	T	C	3: 64,137,471	M1V	probably null	Het
Wdr64	T	C	1: 175,724,702		probably null	Het
Wdr73	T	C	7: 80,893,195	S222G	probably benign	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9644199	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9579585	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9663603	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9992395	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9579540	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9663228	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
R9786:Grin2a	UTSW	16	9653602	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGACTGGATTATAGACACTGTTGC -3'
(R):5'- ACATCCAGGTCCTCACCATTTG -3'

Sequencing Primer
(F):5'- GGATTATAGACACTGTTGCATGAGC -3'
(R):5'- AGGTCCTCACCATTTGTTACC -3'

Posted On

2016-04-15