Incidental Mutation 'R4925:Btaf1'
ID378998
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4925 (G1)
Quality Score188
Status Not validated
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37011333 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1826 (S1826G)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: S1826G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: S1826G

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnni2 A T 7: 142,442,693 E4V probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
Galanos UTSW 19 36949102 missense probably damaging 1.00
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36945314 missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36958382 missense probably benign 0.02
R7402:Btaf1 UTSW 19 37003515 missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36969127 missense probably damaging 1.00
R7493:Btaf1 UTSW 19 37009605 missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36978403 missense probably benign 0.30
R7888:Btaf1 UTSW 19 36965636 missense probably benign 0.10
R7944:Btaf1 UTSW 19 36949165 missense probably benign
R8062:Btaf1 UTSW 19 36992465 missense probably benign 0.00
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCTATATCCAGCCTTTGAC -3'
(R):5'- TTCCCCAATGAAGCAAGAGC -3'

Sequencing Primer
(F):5'- CATCTCTAATTCCAGCAGTAGGGAG -3'
(R):5'- GCACTAAGCTGAGTAGTTTCAGATC -3'
Posted On2016-04-15