Incidental Mutation 'R4926:Pth2r'
ID379001
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
MMRRC Submission 042527-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4926 (G1)
Quality Score183
Status Validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65321984 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 26 (T26A)
Ref Sequence ENSEMBL: ENSMUSP00000114594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027083] [ENSMUST00000140190]
Predicted Effect probably benign
Transcript: ENSMUST00000027083
AA Change: T31A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: T31A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
HormR 59 134 8.15e-28 SMART
Pfam:7tm_2 139 406 5.1e-81 PFAM
low complexity region 447 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140190
AA Change: T26A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114594
Gene: ENSMUSG00000025946
AA Change: T26A

DomainStartEndE-ValueType
HormR 54 129 8.15e-28 SMART
Pfam:7tm_2 134 174 1.1e-13 PFAM
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,395,299 D136V probably damaging Het
Ankrd17 G A 5: 90,300,032 R217W probably damaging Het
Ankrd23 A T 1: 36,531,987 H102Q probably damaging Het
Arfip2 G T 7: 105,637,944 R138S probably damaging Het
Arhgap27 A T 11: 103,339,123 probably null Het
Atg2a T C 19: 6,257,533 L1499P probably damaging Het
Bnc2 A G 4: 84,276,179 S110P probably damaging Het
Ccdc171 T C 4: 83,558,592 probably benign Het
Ccdc7a A G 8: 128,980,054 probably benign Het
Chd5 T C 4: 152,383,311 S1689P probably benign Het
Corin A G 5: 72,372,182 C212R probably damaging Het
Cyp2c65 A G 19: 39,061,153 I42V probably benign Het
Cyp3a25 G A 5: 145,991,456 R260C probably damaging Het
Dock6 T C 9: 21,845,791 Y116C probably damaging Het
Eif3a A G 19: 60,763,218 probably benign Het
Epop T C 11: 97,628,317 D322G probably damaging Het
Eps8l3 T A 3: 107,890,688 probably benign Het
Exph5 T C 9: 53,376,625 S1669P possibly damaging Het
Faah A T 4: 115,999,626 probably benign Het
Fanca A G 8: 123,303,985 C453R probably benign Het
Fcgbp T A 7: 28,086,235 C366S probably damaging Het
Fmn2 A G 1: 174,502,415 T124A unknown Het
Foxi3 C T 6: 70,957,012 S161L probably damaging Het
Foxo3 A T 10: 42,197,024 V499E probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Gm839 A C 6: 89,212,599 noncoding transcript Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
Hnrnpm G T 17: 33,649,801 R551S probably damaging Het
Hspa1l A G 17: 34,978,223 T413A possibly damaging Het
Hspg2 T C 4: 137,542,530 Y2297H probably damaging Het
Ighv1-81 T A 12: 115,920,473 I53L probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrrc41 T C 4: 116,089,324 V412A possibly damaging Het
Map4k4 A T 1: 40,017,225 E1023D probably damaging Het
Mark3 T A 12: 111,618,324 L118* probably null Het
Mrgpra9 T A 7: 47,235,011 T303S possibly damaging Het
Mterf4 T C 1: 93,304,925 E68G probably benign Het
Nckap5 A C 1: 126,528,641 probably benign Het
Nox3 T A 17: 3,669,894 T339S probably damaging Het
Nrip2 A C 6: 128,408,374 H256P probably benign Het
Oas1d T C 5: 120,915,768 V97A probably benign Het
Obox2 T A 7: 15,397,177 probably null Het
Olfr979 T C 9: 40,001,023 probably null Het
Opa1 T C 16: 29,648,973 F989S possibly damaging Het
Padi1 T A 4: 140,824,847 I429F probably damaging Het
Paics A G 5: 76,961,204 D163G probably damaging Het
Pik3c2b G T 1: 133,099,626 E1288* probably null Het
Prdm16 A T 4: 154,341,552 V593D possibly damaging Het
Prpf39 A G 12: 65,044,056 I165M possibly damaging Het
Ptpn21 T C 12: 98,715,195 probably null Het
Rab44 C T 17: 29,139,555 A239V probably benign Het
Rtcb T C 10: 85,955,736 N52S probably benign Het
Sapcd2 T A 2: 25,373,566 probably null Het
Scaf11 T C 15: 96,418,242 E1147G possibly damaging Het
Selenoo T C 15: 89,099,678 Y595H probably damaging Het
Slc2a5 G T 4: 150,120,742 E3* probably null Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sorbs2 A G 8: 45,796,217 K755R probably benign Het
Sorbs3 G T 14: 70,186,945 P513T probably damaging Het
Sowaha T A 11: 53,479,510 E133V possibly damaging Het
Srsf5 T C 12: 80,947,301 probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tcp11l1 T C 2: 104,681,785 I501V probably benign Het
Tert A G 13: 73,648,389 K1080E possibly damaging Het
Tescl T A 7: 24,333,898 M1L possibly damaging Het
Thop1 T A 10: 81,073,367 probably null Het
Tmtc4 T C 14: 122,973,206 H80R probably damaging Het
Toe1 C T 4: 116,804,532 S480N probably damaging Het
Trap1 C A 16: 4,045,488 V557F probably benign Het
Trim30d T C 7: 104,483,357 E91G probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttll8 C A 15: 88,914,165 G789V probably damaging Het
Ulk4 A G 9: 121,258,732 F298S probably benign Het
Wwc1 C T 11: 35,889,400 A243T probably benign Het
Zfp248 A C 6: 118,429,826 H267Q possibly damaging Het
Zfyve26 T A 12: 79,275,011 M945L probably benign Het
Zufsp T C 10: 33,949,438 D16G probably damaging Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R0415:Pth2r UTSW 1 65388439 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1690:Pth2r UTSW 1 65372303 missense probably benign 0.02
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2232:Pth2r UTSW 1 65336769 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3857:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4540:Pth2r UTSW 1 65282201 missense probably benign
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R5871:Pth2r UTSW 1 65388637 missense probably damaging 1.00
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAATCACAGTTTAGAGTTTCC -3'
(R):5'- TCCCTAACACTGAGGAGAATTCTC -3'

Sequencing Primer
(F):5'- TAGTAGCATCACCTGGGACCTAGTG -3'
(R):5'- CACTGAGGAGAATTCTCTGATTTTTG -3'
Posted On2016-04-15